ID: 1184536559

View in Genome Browser
Species Human (GRCh38)
Location 22:45091579-45091601
Sequence CCGCTCGCTCGCTGACGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184536551_1184536559 18 Left 1184536551 22:45091538-45091560 CCCTGTAAAGTGGGGCGCTCCGG No data
Right 1184536559 22:45091579-45091601 CCGCTCGCTCGCTGACGACCTGG No data
1184536553_1184536559 17 Left 1184536553 22:45091539-45091561 CCTGTAAAGTGGGGCGCTCCGGG No data
Right 1184536559 22:45091579-45091601 CCGCTCGCTCGCTGACGACCTGG No data
1184536555_1184536559 -1 Left 1184536555 22:45091557-45091579 CCGGGTTCTTGTCCTGCCTCTGC No data
Right 1184536559 22:45091579-45091601 CCGCTCGCTCGCTGACGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184536559 Original CRISPR CCGCTCGCTCGCTGACGACC TGG Intergenic
No off target data available for this crispr