ID: 1184540792

View in Genome Browser
Species Human (GRCh38)
Location 22:45122900-45122922
Sequence CAATAGGCTATATGGTTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184540792_1184540797 7 Left 1184540792 22:45122900-45122922 CCAATTAACCATATAGCCTATTG No data
Right 1184540797 22:45122930-45122952 TTCTCTGCAAACTAAAAGACAGG No data
1184540792_1184540799 28 Left 1184540792 22:45122900-45122922 CCAATTAACCATATAGCCTATTG No data
Right 1184540799 22:45122951-45122973 GGTGATCATGGAAAAAAAAAAGG No data
1184540792_1184540798 16 Left 1184540792 22:45122900-45122922 CCAATTAACCATATAGCCTATTG No data
Right 1184540798 22:45122939-45122961 AACTAAAAGACAGGTGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184540792 Original CRISPR CAATAGGCTATATGGTTAAT TGG (reversed) Intergenic
No off target data available for this crispr