ID: 1184540792 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:45122900-45122922 |
Sequence | CAATAGGCTATATGGTTAAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1184540792_1184540797 | 7 | Left | 1184540792 | 22:45122900-45122922 | CCAATTAACCATATAGCCTATTG | No data | ||
Right | 1184540797 | 22:45122930-45122952 | TTCTCTGCAAACTAAAAGACAGG | No data | ||||
1184540792_1184540799 | 28 | Left | 1184540792 | 22:45122900-45122922 | CCAATTAACCATATAGCCTATTG | No data | ||
Right | 1184540799 | 22:45122951-45122973 | GGTGATCATGGAAAAAAAAAAGG | No data | ||||
1184540792_1184540798 | 16 | Left | 1184540792 | 22:45122900-45122922 | CCAATTAACCATATAGCCTATTG | No data | ||
Right | 1184540798 | 22:45122939-45122961 | AACTAAAAGACAGGTGATCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1184540792 | Original CRISPR | CAATAGGCTATATGGTTAAT TGG (reversed) | Intergenic | ||
No off target data available for this crispr |