ID: 1184540798

View in Genome Browser
Species Human (GRCh38)
Location 22:45122939-45122961
Sequence AACTAAAAGACAGGTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184540792_1184540798 16 Left 1184540792 22:45122900-45122922 CCAATTAACCATATAGCCTATTG No data
Right 1184540798 22:45122939-45122961 AACTAAAAGACAGGTGATCATGG No data
1184540795_1184540798 8 Left 1184540795 22:45122908-45122930 CCATATAGCCTATTGGAAGGAAT No data
Right 1184540798 22:45122939-45122961 AACTAAAAGACAGGTGATCATGG No data
1184540791_1184540798 17 Left 1184540791 22:45122899-45122921 CCCAATTAACCATATAGCCTATT No data
Right 1184540798 22:45122939-45122961 AACTAAAAGACAGGTGATCATGG No data
1184540796_1184540798 0 Left 1184540796 22:45122916-45122938 CCTATTGGAAGGAATTCTCTGCA No data
Right 1184540798 22:45122939-45122961 AACTAAAAGACAGGTGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184540798 Original CRISPR AACTAAAAGACAGGTGATCA TGG Intergenic
No off target data available for this crispr