ID: 1184543703

View in Genome Browser
Species Human (GRCh38)
Location 22:45150365-45150387
Sequence CTGTCTTCACATATGCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184543698_1184543703 -8 Left 1184543698 22:45150350-45150372 CCCCTGGCCTGACCTCTGTCTTC No data
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data
1184543700_1184543703 -10 Left 1184543700 22:45150352-45150374 CCTGGCCTGACCTCTGTCTTCAC No data
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data
1184543693_1184543703 5 Left 1184543693 22:45150337-45150359 CCCTCTCTCCCTCCCCCTGGCCT No data
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data
1184543695_1184543703 -3 Left 1184543695 22:45150345-45150367 CCCTCCCCCTGGCCTGACCTCTG No data
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data
1184543694_1184543703 4 Left 1184543694 22:45150338-45150360 CCTCTCTCCCTCCCCCTGGCCTG No data
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data
1184543690_1184543703 30 Left 1184543690 22:45150312-45150334 CCTTATAAGAAGAGACACCAGAG 0: 57
1: 212
2: 418
3: 551
4: 870
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data
1184543696_1184543703 -4 Left 1184543696 22:45150346-45150368 CCTCCCCCTGGCCTGACCTCTGT No data
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data
1184543697_1184543703 -7 Left 1184543697 22:45150349-45150371 CCCCCTGGCCTGACCTCTGTCTT No data
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data
1184543699_1184543703 -9 Left 1184543699 22:45150351-45150373 CCCTGGCCTGACCTCTGTCTTCA No data
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data
1184543691_1184543703 13 Left 1184543691 22:45150329-45150351 CCAGAGAGCCCTCTCTCCCTCCC No data
Right 1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184543703 Original CRISPR CTGTCTTCACATATGCATTG AGG Intergenic
No off target data available for this crispr