ID: 1184543809

View in Genome Browser
Species Human (GRCh38)
Location 22:45151300-45151322
Sequence ACTTCAAAAGATGAATTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184543805_1184543809 1 Left 1184543805 22:45151276-45151298 CCATTCTGAGGTACAGGGATTAG No data
Right 1184543809 22:45151300-45151322 ACTTCAAAAGATGAATTTTGGGG No data
1184543800_1184543809 13 Left 1184543800 22:45151264-45151286 CCAAATGCAATCCCATTCTGAGG No data
Right 1184543809 22:45151300-45151322 ACTTCAAAAGATGAATTTTGGGG No data
1184543799_1184543809 20 Left 1184543799 22:45151257-45151279 CCTGTCTCCAAATGCAATCCCAT No data
Right 1184543809 22:45151300-45151322 ACTTCAAAAGATGAATTTTGGGG No data
1184543798_1184543809 21 Left 1184543798 22:45151256-45151278 CCCTGTCTCCAAATGCAATCCCA No data
Right 1184543809 22:45151300-45151322 ACTTCAAAAGATGAATTTTGGGG No data
1184543804_1184543809 2 Left 1184543804 22:45151275-45151297 CCCATTCTGAGGTACAGGGATTA No data
Right 1184543809 22:45151300-45151322 ACTTCAAAAGATGAATTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184543809 Original CRISPR ACTTCAAAAGATGAATTTTG GGG Intergenic
No off target data available for this crispr