ID: 1184548333

View in Genome Browser
Species Human (GRCh38)
Location 22:45189239-45189261
Sequence CCCGTAGGGTACCCGAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184548333_1184548343 23 Left 1184548333 22:45189239-45189261 CCAGACTTCGGGTACCCTACGGG No data
Right 1184548343 22:45189285-45189307 ATGCAACATAGCAAAAACCCTGG No data
1184548333_1184548339 -8 Left 1184548333 22:45189239-45189261 CCAGACTTCGGGTACCCTACGGG No data
Right 1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184548333 Original CRISPR CCCGTAGGGTACCCGAAGTC TGG (reversed) Intergenic