ID: 1184548343

View in Genome Browser
Species Human (GRCh38)
Location 22:45189285-45189307
Sequence ATGCAACATAGCAAAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184548337_1184548343 9 Left 1184548337 22:45189253-45189275 CCCTACGGGTGGTGTTGAGGCTG 0: 18
1: 22
2: 14
3: 7
4: 90
Right 1184548343 22:45189285-45189307 ATGCAACATAGCAAAAACCCTGG No data
1184548338_1184548343 8 Left 1184548338 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG 0: 16
1: 26
2: 13
3: 12
4: 132
Right 1184548343 22:45189285-45189307 ATGCAACATAGCAAAAACCCTGG No data
1184548331_1184548343 26 Left 1184548331 22:45189236-45189258 CCACCAGACTTCGGGTACCCTAC No data
Right 1184548343 22:45189285-45189307 ATGCAACATAGCAAAAACCCTGG No data
1184548333_1184548343 23 Left 1184548333 22:45189239-45189261 CCAGACTTCGGGTACCCTACGGG No data
Right 1184548343 22:45189285-45189307 ATGCAACATAGCAAAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184548343 Original CRISPR ATGCAACATAGCAAAAACCC TGG Intergenic
No off target data available for this crispr