ID: 1184549052

View in Genome Browser
Species Human (GRCh38)
Location 22:45194668-45194690
Sequence GACAGTAAGGTGTTACTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184549052_1184549056 -1 Left 1184549052 22:45194668-45194690 CCTGGGAGTAACACCTTACTGTC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1184549056 22:45194690-45194712 CTGGTTCTCAAGTGGCTAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 133
1184549052_1184549057 22 Left 1184549052 22:45194668-45194690 CCTGGGAGTAACACCTTACTGTC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1184549057 22:45194713-45194735 CTCTGAGCAAGTTTTAAATCCGG 0: 1
1: 0
2: 1
3: 13
4: 161
1184549052_1184549055 -9 Left 1184549052 22:45194668-45194690 CCTGGGAGTAACACCTTACTGTC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1184549055 22:45194682-45194704 CTTACTGTCTGGTTCTCAAGTGG 0: 1
1: 1
2: 0
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184549052 Original CRISPR GACAGTAAGGTGTTACTCCC AGG (reversed) Intronic
905971799 1:42147091-42147113 GCCAGAAAGGTGTTACACCTTGG + Intergenic
906580721 1:46933494-46933516 GACACCAAGGTGCAACTCCCTGG - Intronic
907109959 1:51918185-51918207 GAAACTAAGGTTTCACTCCCAGG + Exonic
913370023 1:118088041-118088063 GACAGTAGGGTGTTTCTACAAGG - Intronic
916107882 1:161443883-161443905 GAAAGTGATGAGTTACTCCCTGG - Intergenic
916109467 1:161451265-161451287 GAAAGTGATGAGTTACTCCCTGG - Intergenic
916111052 1:161458670-161458692 GAAAGTGATGAGTTACTCCCTGG - Intergenic
916112640 1:161466056-161466078 GAAAGTGATGAGTTACTCCCTGG - Intergenic
918287657 1:183073612-183073634 GCCAGTTTGGTGTTACTCCCAGG + Intronic
1063647227 10:7897183-7897205 GACAATAAGGTGGTGCTCCCAGG - Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065096426 10:22285277-22285299 CACTGTAAACTGTTACTCCCTGG + Intergenic
1065284063 10:24170292-24170314 GAGAGGAAGGTGGGACTCCCAGG + Intronic
1069041500 10:63700316-63700338 GACATTACTGTGTTACTCCCGGG - Intergenic
1075322121 10:121499767-121499789 GACAGCACAGTGTTCCTCCCCGG + Intronic
1081821030 11:45995014-45995036 GACAATTAGGTCTTTCTCCCAGG - Intronic
1084600353 11:70141869-70141891 GACAGAAACCTGTTACTGCCTGG + Intronic
1085096702 11:73766874-73766896 GTAAGTGAGGTGTTACTTCCAGG + Intergenic
1092196580 12:6553271-6553293 GACAGGAAGGAGTTATTCCTTGG - Intronic
1097051246 12:56224518-56224540 GCCAGTAAGATTCTACTCCCTGG + Exonic
1114361709 14:21981151-21981173 AACAGTAAGGAGTTTCCCCCTGG - Intergenic
1126376070 15:47997730-47997752 GACAGTCAGGCGTTTCTCACAGG - Intergenic
1126571076 15:50151399-50151421 GACAAAAAGTTGTTACTCTCTGG - Intronic
1131993760 15:98114748-98114770 GACAGAAAGCTGTTTCTACCTGG + Intergenic
1134297749 16:12961891-12961913 GACTGGAAGGTGTGACTCCCTGG - Intronic
1140307861 16:73820371-73820393 GCCAGTTAAGAGTTACTCCCAGG - Intergenic
1147838671 17:43354555-43354577 GACAACAAGCTGTTACTACCAGG - Intergenic
1151264332 17:72942522-72942544 GAGAGTGAGGTGTAACTCCTAGG - Intronic
1151427701 17:74041742-74041764 GAGAGGAAGGTGTTTCTCCTAGG - Intergenic
1159680364 18:71342879-71342901 GACAGTAGGCTTTTACTCCTAGG - Intergenic
929828102 2:45325946-45325968 GACATGAAGGTGTTTCTACCAGG - Intergenic
937467736 2:122149444-122149466 GACAGGCAGCTGATACTCCCTGG + Intergenic
938870172 2:135467237-135467259 GAGAGAAAGTTGTGACTCCCTGG - Intronic
944694459 2:202188667-202188689 GACAGTAAAGTGGTAGACCCAGG + Intronic
1174481200 20:50832764-50832786 GACAGGAAGATGTCACTCCGTGG - Intronic
1177854043 21:26382172-26382194 GACATTCAGGTGGTACTCACAGG + Intergenic
1181690044 22:24554320-24554342 GACCTTCAGGTGTCACTCCCAGG - Intronic
1184549052 22:45194668-45194690 GACAGTAAGGTGTTACTCCCAGG - Intronic
953710424 3:45265226-45265248 TACAGTAATGTGTAATTCCCTGG + Intergenic
958270352 3:91491762-91491784 GTCAGAAAGGTGTTACTCAAGGG - Intergenic
959150835 3:102605634-102605656 GTCAGTAAGGTGTAACACTCAGG - Intergenic
968797241 4:2715506-2715528 TACAGGAAGGTGGTTCTCCCAGG - Intronic
969186518 4:5478731-5478753 GAAGCCAAGGTGTTACTCCCCGG + Intronic
969342822 4:6553068-6553090 GACAGGAGGCTGTTACTCCCTGG + Intronic
971321983 4:25613075-25613097 AACCTTTAGGTGTTACTCCCAGG + Intergenic
972881189 4:43424965-43424987 GAAAGCAAAGTGTTTCTCCCAGG + Intergenic
972992258 4:44834932-44834954 GACAATTAGGTGTCACCCCCAGG + Intergenic
976268759 4:83209504-83209526 GAAAGAGAGGTGATACTCCCAGG + Intergenic
981186867 4:141814544-141814566 CACAGTAAGGTAGTACTCCAGGG - Intergenic
986808796 5:11333919-11333941 GACAGAAAGGTGTGAACCCCAGG + Intronic
993558165 5:89367573-89367595 TACATTTTGGTGTTACTCCCTGG + Intergenic
999162266 5:149511557-149511579 GACAGTAAGCTGGTACCCACTGG - Intronic
1002897190 6:1386155-1386177 GAAATTAAGGTATTCCTCCCAGG + Intergenic
1009172845 6:60422526-60422548 GTCAGAAAGGTGTTACTCAAGGG + Intergenic
1011826160 6:91308212-91308234 TATAGTAGGGTTTTACTCCCTGG - Intergenic
1013470678 6:110461099-110461121 GAAAGTGAGGTGGTACTGCCTGG + Intronic
1017310852 6:152975885-152975907 AACAGTCAGGTGTTACAGCCAGG - Intronic
1024178563 7:46864436-46864458 GACAGCACTGTGTTACTGCCAGG - Intergenic
1024696040 7:51857616-51857638 GACAGTAGGGTATTACAGCCTGG + Intergenic
1032796471 7:135281098-135281120 GAAAGTAAGGTTTTCCTCCTTGG + Intergenic
1035945279 8:3954935-3954957 CACAGAAAGTTGTTTCTCCCTGG + Intronic
1037088538 8:14883330-14883352 GACTGTTTGGTGTTACTCCAGGG + Intronic
1043122165 8:76340198-76340220 GAAATTAAGGTGTTATTCTCAGG + Intergenic
1052646102 9:31235719-31235741 GAGATAAAGATGTTACTCCCAGG - Intergenic
1055776960 9:79776875-79776897 CAAAGTAAGGTGATACTTCCTGG - Intergenic
1057330156 9:94106764-94106786 CAGAGTAATGTGTAACTCCCTGG - Intronic
1058756476 9:108087364-108087386 GACAGTGAAGTGTTTATCCCTGG + Intergenic
1062010565 9:134264632-134264654 GACAGGCAGGTGTCCCTCCCGGG + Intergenic
1186480903 X:9895501-9895523 GACAGGACGGTGTTACCCGCTGG + Exonic
1188947588 X:36326143-36326165 GACAGTATGGTATTACTGCAAGG - Intronic
1193112496 X:77743602-77743624 GCCAGTAAGGTGGTACTTGCAGG - Intronic
1199460399 X:148077492-148077514 GACAGTAAGGTGATTCTGACAGG - Intergenic