ID: 1184549627

View in Genome Browser
Species Human (GRCh38)
Location 22:45197542-45197564
Sequence GCATCTGTGGCCACTCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184549615_1184549627 17 Left 1184549615 22:45197502-45197524 CCTGAGAGCCTCCCCTCGCCCGT 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 137
1184549616_1184549627 9 Left 1184549616 22:45197510-45197532 CCTCCCCTCGCCCGTGAGTAACA 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 137
1184549619_1184549627 4 Left 1184549619 22:45197515-45197537 CCTCGCCCGTGAGTAACACACAC 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 137
1184549618_1184549627 5 Left 1184549618 22:45197514-45197536 CCCTCGCCCGTGAGTAACACACA 0: 1
1: 0
2: 1
3: 3
4: 52
Right 1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 137
1184549623_1184549627 -2 Left 1184549623 22:45197521-45197543 CCGTGAGTAACACACACCTGGGC 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 137
1184549621_1184549627 -1 Left 1184549621 22:45197520-45197542 CCCGTGAGTAACACACACCTGGG 0: 1
1: 0
2: 5
3: 19
4: 131
Right 1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 137
1184549617_1184549627 6 Left 1184549617 22:45197513-45197535 CCCCTCGCCCGTGAGTAACACAC 0: 1
1: 0
2: 1
3: 12
4: 43
Right 1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184549627 Original CRISPR GCATCTGTGGCCACTCAAGA GGG Intronic
901586830 1:10302655-10302677 GCATCTGTGCTCACTCATGGGGG + Intronic
905543650 1:38780301-38780323 GCATCTCTGACCACCCACGAGGG + Intergenic
906038591 1:42768372-42768394 CCATCTGTGGACACTGAAGAGGG - Intronic
906566844 1:46806957-46806979 GCAGCTGCAGCCCCTCAAGAGGG - Intronic
909353971 1:74685915-74685937 GAATCTGTGGCAACCCTAGAAGG - Intergenic
911843100 1:102710141-102710163 GCATCTGTGGTCATTTTAGAAGG - Intergenic
912567339 1:110597588-110597610 GCATATGTGTCCATTCCAGAAGG + Intronic
915899284 1:159834809-159834831 GCATCTTTGGCCACTGAGAAGGG + Exonic
917602791 1:176594656-176594678 GCGACTGTGGCTAATCAAGATGG - Exonic
919597095 1:199577825-199577847 TCTTCTGTGGCCATTAAAGAGGG - Intergenic
920080147 1:203367170-203367192 GCAGCTGTGGCCCCACGAGAGGG - Intergenic
922770039 1:228176703-228176725 GCACCTGTGGCCCCCCAGGATGG - Exonic
1063425169 10:5945206-5945228 GCCGCTGTGGTCACTCAGGAGGG + Intronic
1064177627 10:13088887-13088909 GCACCTGTAGCTACTCAGGAGGG + Intronic
1070166939 10:73906123-73906145 GCATCTATTGCCACCCAACATGG + Intergenic
1070686627 10:78489531-78489553 GCCTCTGTGGGCAGTGAAGATGG - Intergenic
1071510727 10:86261039-86261061 GCCTCTGTGCCCACTCCACAGGG + Intronic
1073774797 10:106773378-106773400 GGGTCTGTGGCCACTCAGGTGGG - Intronic
1074974987 10:118572776-118572798 GCCTCTGTTGACACTCTAGAGGG - Intergenic
1076012744 10:127003600-127003622 GCCTCTGTGCTCACTCCAGAGGG + Intronic
1076463133 10:130660056-130660078 CCAGCTGTGGCCACTCAGGGAGG + Intergenic
1081662690 11:44897573-44897595 GCACCTGAGGCCACTCCAGCGGG - Intronic
1081937285 11:46913723-46913745 GCATCCCTGACCACTTAAGAAGG + Intronic
1083484392 11:62974336-62974358 GCATCTGAGGCCACTCTGGTGGG + Intronic
1084012431 11:66359975-66359997 GCCTCTGGGGCCACTCAAAAGGG + Intronic
1085699225 11:78731391-78731413 GCATCGGAAGCCACTCAACAGGG + Intronic
1088882439 11:113982518-113982540 GCCACAGTGGTCACTCAAGAGGG + Intronic
1089398485 11:118151165-118151187 GCCTCTGTGGGCAACCAAGAGGG - Intronic
1091904015 12:4168279-4168301 CCAACTGTGGCCATGCAAGAAGG + Intergenic
1092531397 12:9348585-9348607 GCATCTGGAGCATCTCAAGAGGG + Intergenic
1092907957 12:13119194-13119216 GCATCTGTTGCCACTGGAAATGG - Intronic
1094502374 12:31032929-31032951 GCATCTGGAGCATCTCAAGAGGG + Intergenic
1098618651 12:72562897-72562919 GGATCAGTGGACACTCCAGATGG + Exonic
1098930144 12:76402200-76402222 GATTCTATGGCCACTCAGGAAGG + Intronic
1101642857 12:106601167-106601189 GCAGCTGTGGCCTCTCCAGGGGG - Exonic
1101749912 12:107574982-107575004 GCATCTGTGGGCACCAAAGCCGG - Intronic
1103858606 12:123993090-123993112 GCCTTAGTGGCCACTTAAGAGGG + Intronic
1106546626 13:30736627-30736649 GCATCTGTCCACACTCAAGATGG - Intronic
1113646050 13:111996779-111996801 GCTGCTGTGTTCACTCAAGAGGG - Intergenic
1117235282 14:53767977-53767999 CCATCTGAGGCCCCTCCAGATGG - Intergenic
1119665895 14:76484711-76484733 CCATCTGTGACCAACCAAGAGGG + Intronic
1120509504 14:85396440-85396462 GCAGCTGTGGCCAATAAAAAGGG + Intergenic
1125135877 15:36342081-36342103 GCATCTGTTGACACTCAAGTCGG - Intergenic
1127175466 15:56350501-56350523 GCATCTGTGGGCCCACAATATGG - Intronic
1129296099 15:74600962-74600984 GCATATGTGGACCCTCTAGATGG - Intronic
1129333856 15:74841008-74841030 CCATCTGTGGCCACATAGGAGGG - Intronic
1134339358 16:13331021-13331043 GCATCTGTGGTTATTCAAGGTGG - Intergenic
1138129325 16:54466204-54466226 GCAACAGTGGCCATGCAAGAGGG - Intergenic
1138582766 16:57952355-57952377 GCATCAGTGGCCACTCCTTATGG + Intronic
1140591251 16:76355395-76355417 ACCGCTGTGGCCACTCAAGGGGG + Exonic
1141812927 16:86388207-86388229 CCATCTGTGGTCACTGAAGTGGG - Intergenic
1142032408 16:87845141-87845163 GCATCTGTCACCACACATGAGGG + Intronic
1142933194 17:3306052-3306074 GCAGCTCTGGATACTCAAGAAGG + Intergenic
1143619782 17:8074168-8074190 GACTCTGTGCCCACTCCAGATGG + Intronic
1144061002 17:11583338-11583360 GCAGCTGTAGCCACCCAAGTTGG - Intergenic
1145015842 17:19397670-19397692 GCTTCTGTTGACACTTAAGAGGG + Intergenic
1145848035 17:28061026-28061048 GTATCAGTGACCACTTAAGATGG + Intronic
1150520902 17:65865982-65866004 GCAGCTGTGGTCACTCAGGTCGG + Intronic
1151288797 17:73133494-73133516 CCTCCTGTGGCCACTCAAGATGG + Intergenic
1152718013 17:81909113-81909135 CCAGCTGTAGCCACACAAGAGGG + Intronic
1153080559 18:1218765-1218787 GTATCAGTGACCACTCTAGATGG + Intergenic
1153617406 18:6947534-6947556 GCTTCTGTGGCCACAGATGAAGG - Intronic
1154226869 18:12513126-12513148 GCTTGTGTGGCCTCTGAAGATGG - Intronic
1155447028 18:25923076-25923098 GCATCTGTGGAGACACAAGTGGG - Intergenic
1155539461 18:26852860-26852882 GCCTTTGTGGCAACTGAAGATGG - Exonic
1157893524 18:51441951-51441973 GCATCAGTGGATACTCAATAAGG + Intergenic
1157927842 18:51785618-51785640 GGATGTGTGGCCACTCAATAAGG + Intergenic
1159714552 18:71805525-71805547 TCATCTGAGGCCAATAAAGAAGG + Intergenic
1160506622 18:79430803-79430825 GCAGGTGTGGCCACTGCAGAGGG + Intronic
1165770004 19:38374564-38374586 GCCTCTGTCGTCACTCAAGATGG - Exonic
929839651 2:45444776-45444798 GCATCAGAAGCCACTCAAGTTGG + Intronic
931172208 2:59815178-59815200 CCTGCTGAGGCCACTCAAGAAGG + Intergenic
931431405 2:62211720-62211742 GCTTCTGAGGCCACACTAGAAGG - Intronic
931756074 2:65375801-65375823 GCCTCTTTCTCCACTCAAGATGG + Intronic
933895954 2:86809583-86809605 GCATCCGCAGCCCCTCAAGAAGG + Intergenic
934219073 2:90064941-90064963 GCAGTGGTGGCCACTCAAGGTGG + Intergenic
934946854 2:98548501-98548523 GTAACTCTGGCCAGTCAAGAAGG + Intronic
935225288 2:101047308-101047330 CCATGTGTGGCCACTCCAGCAGG - Intronic
938307332 2:130264882-130264904 CCATCTGTGGCCACAGCAGAGGG - Intergenic
939775750 2:146385601-146385623 ACAGCTGTGGGCACTCAAGGAGG - Intergenic
940398846 2:153223046-153223068 GCAGCTCTGGCCTCTCCAGATGG + Intergenic
942454965 2:176131043-176131065 GCCACTGTGGCTACACAAGAAGG - Intronic
944213274 2:197228563-197228585 GCATCTGGGGCCCCTAGAGATGG - Intronic
946161426 2:217838320-217838342 GCATCTGTGGCCCCTGAACATGG - Intronic
1170700386 20:18698301-18698323 GCATCAGTGGACACCCAGGATGG + Intronic
1171113909 20:22508247-22508269 GTCTCTGTGGCCACCCGAGAGGG + Intergenic
1172781049 20:37437286-37437308 TCATCTGTGGCCAAACAGGAGGG - Intergenic
1175833448 20:61979385-61979407 GCACCCATGGCCACTCTAGAGGG + Intronic
1179642920 21:42758980-42759002 GCATCTGTGGGCACAGGAGAAGG - Exonic
1180899484 22:19360161-19360183 GCTTGTGTGGCCACTCAAGTGGG + Intronic
1183747622 22:39700688-39700710 GCTTCTAAGGCCACTGAAGAAGG + Intergenic
1184324032 22:43768480-43768502 GCATCTGTGGCTTTTCTAGATGG - Intronic
1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG + Intronic
950229283 3:11261868-11261890 GTATCTGTGCACACTTAAGAGGG - Exonic
954368704 3:50159212-50159234 GCATCTGTGGCCAATAAAGTGGG - Intronic
960528242 3:118734812-118734834 GCAGCTGTGGCCACTGGTGACGG - Intergenic
968570366 4:1337158-1337180 GCATCCGAGGCCCCTCAACACGG - Intronic
968855242 4:3115383-3115405 GCATCTGCCAGCACTCAAGAAGG + Exonic
969832151 4:9806607-9806629 GCATTTGGCTCCACTCAAGAGGG + Intronic
970717852 4:18948132-18948154 GCATCTGACGCCAGTCAGGATGG - Intergenic
972847648 4:43009084-43009106 GCCTCTGTGGCCTCCAAAGAAGG - Intronic
976771572 4:88658818-88658840 GCATTTGTTGCCACTTAACAGGG - Intronic
982788945 4:159568002-159568024 CCATCTCAGGCCACTCAGGATGG - Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
987116877 5:14732724-14732746 GCATCTGGGGAAACTGAAGATGG + Intronic
990989784 5:61673657-61673679 GCAGCTTAGGCCTCTCAAGAGGG + Intronic
993287759 5:86021981-86022003 CCTTCTGTGGTCACTAAAGAGGG + Intergenic
995401074 5:111742320-111742342 TCATCAGTGGCCTCTCAAGATGG - Intronic
999957437 5:156717908-156717930 GCATATCATGCCACTCAAGAGGG - Intronic
1001206379 5:169767079-169767101 CCATCTCTCGCCACTCAAAATGG - Intronic
1003714635 6:8632556-8632578 CCATATCTGGCCACTCAAGTGGG - Intergenic
1004520271 6:16355213-16355235 GCATCTGTGGGCATCCAAGCTGG - Intronic
1006802201 6:36766308-36766330 GCTTCTGTGGCCCCTCCAGGAGG + Intronic
1012464483 6:99502230-99502252 GCTTCTGTGTCCACTCCAGAGGG - Intronic
1013735484 6:113222099-113222121 GCACCTGCGGCCAGGCAAGACGG - Intergenic
1014934092 6:127365994-127366016 GCAGCTGAGCCCACTCAAGCTGG - Intergenic
1014973306 6:127846143-127846165 ACTTCTGTGGCCACACATGATGG + Intronic
1016614342 6:146029034-146029056 GCAGCTGTGGTCACTGAGGAAGG - Intronic
1016667991 6:146666381-146666403 TCATCTATGGCAAGTCAAGATGG - Intronic
1017724319 6:157266690-157266712 GCACCTGCGGCCACTCAGAAGGG - Intergenic
1019650500 7:2155097-2155119 GCTTCTGTGGCCTGGCAAGAAGG + Intronic
1024556477 7:50607432-50607454 GCTACTGTGGCCCCTCAGGAGGG + Intronic
1030359730 7:108582274-108582296 GCATTTCTGGCCAATAAAGATGG - Intergenic
1031232506 7:119126708-119126730 GCATATGAGGGCACTCAGGATGG + Intergenic
1031511264 7:122653119-122653141 CAATCTCTGGCAACTCAAGAAGG - Intronic
1031912992 7:127536975-127536997 GCGTCTGTCACCACTGAAGATGG + Intergenic
1032012436 7:128355733-128355755 GCCTCTGTGGCCTCTGCAGAGGG + Intronic
1033905894 7:146202157-146202179 TCAACTGTGGCAACTCAAAAAGG - Intronic
1034284450 7:149875254-149875276 GCATTTGTGGCAACCCAACAGGG - Intronic
1035277075 7:157754068-157754090 GGATCTGTGGCAACCCAGGAAGG + Intronic
1037270372 8:17122753-17122775 GCATGTGTTGCCACAGAAGAGGG - Intergenic
1037619743 8:20553212-20553234 GCATCTGTTGCCACTTTAGTTGG - Intergenic
1038269249 8:26061932-26061954 GCATAAGTGTCCACTCATGAAGG - Intergenic
1039507767 8:38064392-38064414 GGACATGTGGCCAATCAAGAAGG + Intergenic
1042824655 8:72967849-72967871 GCCACTGTGCCCAGTCAAGATGG - Intergenic
1043751993 8:83949275-83949297 ACCTCTGTTACCACTCAAGATGG - Intergenic
1047089114 8:121554303-121554325 GTAATTGTGGCCACTTAAGATGG + Intergenic
1049002281 8:139833693-139833715 GCAGCTGCGGCCACCAAAGAAGG + Intronic
1052631789 9:31050823-31050845 GTATCTGTGGACCCTAAAGATGG - Intergenic
1057078493 9:92154219-92154241 GCATCTGTGGTCTCTGACGATGG + Intergenic
1059488163 9:114643412-114643434 GCATCTGGGGGCACTCCAAAAGG + Exonic
1059549256 9:115212052-115212074 GCATCAGTGGTCACTCAGCAAGG + Intronic
1061858124 9:133454287-133454309 GCTTCCGTGGCCAGGCAAGATGG - Intronic
1185591823 X:1282458-1282480 ACATCTTTGGCATCTCAAGATGG - Intronic
1189099937 X:38178469-38178491 GCTTCTGTGGCCATTCATGAAGG + Intronic
1190104190 X:47547084-47547106 GCAGCTGAGGCCACTCCTGAAGG - Intergenic
1190816296 X:53932838-53932860 GCATTTCTGGCCACTCAAACTGG + Intergenic
1195285529 X:103378912-103378934 GAAAGTGTGGCCAATCAAGAAGG - Intergenic
1195533271 X:105982172-105982194 CCCTCTTTGGCCACTCAGGACGG + Intergenic
1200973712 Y:9183848-9183870 CCATCTGAGGCCAGTCAAAATGG + Intergenic
1202137403 Y:21680948-21680970 CCATCTGAGGCCAGTCAAAATGG - Intergenic