ID: 1184554732

View in Genome Browser
Species Human (GRCh38)
Location 22:45227038-45227060
Sequence TCACTCCTCCACTCCCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 489}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184554727_1184554732 18 Left 1184554727 22:45226997-45227019 CCCTGGCAGAGGAACTCAGGCCA 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1184554732 22:45227038-45227060 TCACTCCTCCACTCCCTGCCCGG 0: 1
1: 0
2: 4
3: 41
4: 489
1184554729_1184554732 -2 Left 1184554729 22:45227017-45227039 CCATGTGCTTCAGCTGCTCCCTC No data
Right 1184554732 22:45227038-45227060 TCACTCCTCCACTCCCTGCCCGG 0: 1
1: 0
2: 4
3: 41
4: 489
1184554725_1184554732 23 Left 1184554725 22:45226992-45227014 CCAAACCCTGGCAGAGGAACTCA 0: 1
1: 0
2: 0
3: 30
4: 407
Right 1184554732 22:45227038-45227060 TCACTCCTCCACTCCCTGCCCGG 0: 1
1: 0
2: 4
3: 41
4: 489
1184554728_1184554732 17 Left 1184554728 22:45226998-45227020 CCTGGCAGAGGAACTCAGGCCAT 0: 1
1: 0
2: 1
3: 19
4: 201
Right 1184554732 22:45227038-45227060 TCACTCCTCCACTCCCTGCCCGG 0: 1
1: 0
2: 4
3: 41
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184554732 Original CRISPR TCACTCCTCCACTCCCTGCC CGG Intronic
900478622 1:2887736-2887758 CCACTGCTCCAGTCCCTGCTTGG + Intergenic
900516015 1:3082578-3082600 TCACTCCTGGACTCCCTTGCTGG + Intronic
900631732 1:3639946-3639968 TCACTCCTGCAAACGCTGCCAGG + Intronic
901225668 1:7611714-7611736 TCCCACCTGCACTCGCTGCCAGG + Intronic
901788234 1:11638709-11638731 TCCCTCCTGCTCTCCCTCCCCGG + Intergenic
902042603 1:13503663-13503685 TCATTCCTGCACTCCTTACCTGG + Intronic
902178361 1:14668640-14668662 TGCCTCCTCCCCTCCCTGCTAGG + Intronic
902378442 1:16041440-16041462 TCACTTGGCCACTCCATGCCGGG - Intergenic
902691190 1:18110828-18110850 CCACTCCTCCATCCCCAGCCCGG - Intronic
902692497 1:18118572-18118594 TCACTCCTTCCGCCCCTGCCTGG - Intronic
902845857 1:19110303-19110325 TCCCTCCTCCCCTCCCAGTCCGG + Intronic
903016877 1:20367039-20367061 TCCCTCCACCCCTGCCTGCCCGG - Intergenic
903365271 1:22802099-22802121 CCCCTCCTCCACTCTCTGCCTGG - Intronic
903563992 1:24250658-24250680 TCTCTCATCTACTCCCTGCGTGG - Intergenic
904382863 1:30123305-30123327 TCCCTCCTTCCCTCCCAGCCAGG - Intergenic
904875629 1:33652450-33652472 TCTCTCCTCAGCTCCCTGCGGGG - Exonic
905646377 1:39627263-39627285 TGCCTCCTCCACTCACTCCCTGG + Intronic
906282609 1:44564675-44564697 TCACTGCACCTCTGCCTGCCAGG - Intronic
906528151 1:46508441-46508463 TCACTCCTTTAGACCCTGCCAGG + Intronic
906568785 1:46818875-46818897 CAACTCCTCCACACCCAGCCTGG - Exonic
906802724 1:48751617-48751639 TCCCACCTCCATTTCCTGCCTGG + Intronic
907059406 1:51406173-51406195 GCCCTCCTCCACTTCCTGACGGG + Intronic
907331667 1:53675895-53675917 TCCCACCTCCTCTCCCTACCTGG + Intronic
907640236 1:56181701-56181723 TCACTCCTCCAGTCTTTTCCAGG - Intergenic
907718698 1:56951659-56951681 TCACTAATCCTCTCCCTGCAGGG + Intronic
912749792 1:112277172-112277194 TCACTCATTCACTCTCAGCCAGG - Intergenic
912915748 1:113812535-113812557 CCACTCCTCCACTCAGAGCCGGG - Intergenic
913709263 1:121465064-121465086 TCTCACCTCCACTCCCCACCAGG - Intergenic
914385316 1:147163674-147163696 TCCCTCCTCCCCTCCGTCCCTGG - Intronic
914422893 1:147545424-147545446 TCACTCCTCAACTCCCCACTTGG - Intronic
915018962 1:152761638-152761660 TCACTCTTCCCCACTCTGCCTGG + Exonic
915033611 1:152904695-152904717 TCTCTCCTCCTCTCACTTCCTGG + Intergenic
915247138 1:154564472-154564494 CCACTTCTTCACTCCCAGCCTGG - Intergenic
915304473 1:154969810-154969832 TCACTCCCCCACCCCCACCCTGG - Intronic
915728395 1:158035268-158035290 TCTCTACTACACTCGCTGCCTGG - Intronic
915913400 1:159928054-159928076 TCTCTGCTCCACTCCCACCCTGG - Intronic
916020697 1:160789766-160789788 CCACCCCTCCACTGCCTCCCAGG - Intergenic
916059644 1:161089670-161089692 TCCCTCCTTCCCTCCCTCCCTGG - Intergenic
916560734 1:165932413-165932435 TCACTTCTCCAAGCCCTGCCTGG - Intergenic
916561002 1:165934059-165934081 TCACTTCTCCAAGCCCTGCCTGG - Intergenic
917738562 1:177942074-177942096 TTTCTCCTTCTCTCCCTGCCTGG - Intronic
918626251 1:186659108-186659130 TCTCTCCTCCTCTTCCTGCTAGG + Intergenic
919531769 1:198729942-198729964 TGTCTCCTCAAGTCCCTGCCAGG + Intronic
920048562 1:203149522-203149544 CCTCTCCTCAACTCCCGGCCTGG - Intronic
920195524 1:204223666-204223688 TCCCTGCCTCACTCCCTGCCTGG - Intronic
920279840 1:204834535-204834557 TCACTCCTCCCCTCCCGGGCTGG + Intronic
920966431 1:210705141-210705163 CCCCTCTACCACTCCCTGCCAGG + Intronic
921258433 1:213363535-213363557 TCACTTCTCCCTTCTCTGCCAGG - Intergenic
922065148 1:222130299-222130321 TCAGTTCTCCACACACTGCCAGG - Intergenic
922490600 1:226013578-226013600 TCAATCCGCCCCTCCCAGCCAGG + Intergenic
923468939 1:234273134-234273156 TCACTCCAGCTGTCCCTGCCTGG + Intronic
924415292 1:243850706-243850728 CCTCTGCTCCCCTCCCTGCCCGG + Intronic
924822229 1:247504327-247504349 TCCTTCCTCCACTACCTGTCAGG + Intergenic
1063204042 10:3813664-3813686 CCTCCCCTCCAGTCCCTGCCGGG + Intergenic
1063212407 10:3892964-3892986 GCCCTCCACCACTCCCTGCGTGG + Intergenic
1063583857 10:7333687-7333709 TCTCTCCCCCACTCCCTACACGG + Intronic
1064031341 10:11885270-11885292 TCACCCCTGCCCTCCCAGCCTGG - Intergenic
1064373237 10:14772565-14772587 TCACTGCTTCCCTCCCTGCCTGG + Intronic
1064760737 10:18617594-18617616 CCATTCCTCCACTCCTTGGCAGG + Intronic
1065019652 10:21494168-21494190 AAACTCCTACACTTCCTGCCCGG + Exonic
1065206516 10:23362417-23362439 TAACTCCTCTGCTCCCTCCCAGG + Intergenic
1066073573 10:31847763-31847785 GCACTCTCCCCCTCCCTGCCTGG - Intronic
1066108655 10:32177595-32177617 CCACTCTCCCACTCCCTGCTGGG - Intergenic
1066653305 10:37679554-37679576 TCTCTCCTCCAGGCCCTTCCAGG - Intergenic
1067082781 10:43221084-43221106 TCACTCCTCTTCTCCCAGCAGGG - Intronic
1067110693 10:43397383-43397405 TCCTTCCCCCACTTCCTGCCTGG - Intronic
1069771738 10:70904810-70904832 TTCCTCCTCCACTCCCTGCCAGG - Intergenic
1069844626 10:71362426-71362448 GCACTCCTCAGCTCCCTGCTGGG + Exonic
1070813880 10:79311538-79311560 TCCCTCCAGCCCTCCCTGCCCGG - Intronic
1070835488 10:79444930-79444952 TCCCGCCCCCTCTCCCTGCCAGG - Intronic
1072201721 10:93166083-93166105 TCACTTCTCTACTCCCTTGCAGG - Intergenic
1072491174 10:95907557-95907579 TCGCGCCTCCACGCCCTGCGCGG + Intronic
1072618922 10:97067284-97067306 CCCTTCCTCCACTCCCTGTCAGG + Intronic
1073522791 10:104150286-104150308 CCATACATCCACTCCCTGCCAGG + Intronic
1074271974 10:111962943-111962965 TTACTCCTGCACTCCCTTCTAGG + Intergenic
1074682363 10:115920469-115920491 ACACTCACCCATTCCCTGCCAGG + Intronic
1075587443 10:123667865-123667887 TCCCTCCTTCTCTCCCTGACAGG - Intronic
1076637187 10:131889796-131889818 TCACTCCCGCGCTCACTGCCGGG + Intergenic
1076799141 10:132812583-132812605 CCACCCCTGCACCCCCTGCCTGG - Intronic
1077264685 11:1642819-1642841 TCCCTCCTTCCCTCCCTCCCAGG + Intergenic
1077297691 11:1833777-1833799 TCAATGCCCCACTCCCTGGCAGG - Intronic
1077312253 11:1894206-1894228 ACACTCCCACACTCCCAGCCTGG - Intergenic
1077587575 11:3465710-3465732 TAACACCTCCCCTCCCTGCGTGG + Intergenic
1077588992 11:3477249-3477271 TCACTTGTCCTCTCTCTGCCTGG + Intergenic
1077964709 11:7117020-7117042 TCCCTCCTCCACCCCATCCCAGG - Intergenic
1078666307 11:13328518-13328540 TGGCCCCTCCACTCCCTGCCTGG + Intronic
1079126001 11:17719343-17719365 TCGCTCCCTCCCTCCCTGCCCGG + Intergenic
1081653364 11:44840259-44840281 TGCCTCCCCCACTCCCTGGCTGG - Intronic
1081758353 11:45560322-45560344 TCCCTCCCCCACTTCCTGACTGG + Intergenic
1082794615 11:57370189-57370211 TCTCACCTTCACTCCTTGCCTGG + Exonic
1083174023 11:60938275-60938297 CCCCTCCTCCCCTTCCTGCCAGG + Intronic
1083283884 11:61645264-61645286 TAACTGCTCCCCTGCCTGCCTGG + Intergenic
1083419789 11:62546312-62546334 TCCCACCTCCTCTCCCTGCATGG - Intronic
1083677426 11:64334167-64334189 TCATGCCTCAGCTCCCTGCCTGG + Intergenic
1083709935 11:64541707-64541729 AAACTCCTCCATTCCCAGCCTGG + Intergenic
1083837150 11:65278126-65278148 TCACATTTCCACTCCCTGACTGG - Intronic
1083925617 11:65804271-65804293 GCTCCCCTCCACTCCCTTCCGGG + Intergenic
1084244690 11:67848872-67848894 TCACTTGTCCTCTCTCTGCCTGG + Intergenic
1084741019 11:71139736-71139758 CCACCCCACCACTCCCTGCGTGG + Intronic
1084810835 11:71610098-71610120 TCACTCCCCCTCTCCCACCCTGG + Intergenic
1084827994 11:71745684-71745706 TCACTTGTCCTCTCTCTGCCTGG - Intergenic
1084829421 11:71757211-71757233 TAACACCTCCCCTCCCTGCGTGG - Intergenic
1085261598 11:75208628-75208650 TCTCTCCTCCACTGTCAGCCAGG + Intergenic
1087094662 11:94307403-94307425 TCCCTCCTCCATCCCCTGCAGGG + Exonic
1087283722 11:96241719-96241741 TAAGTCCTCCACTTCCTGCTGGG + Intronic
1088295529 11:108289963-108289985 TCCTTCCTCCTCACCCTGCCGGG + Intronic
1089191026 11:116653415-116653437 TCACTCCTCAATTCCCTGCCCGG - Intergenic
1090095881 11:123741460-123741482 CCCCTCCTCCCCGCCCTGCCCGG + Intronic
1090645901 11:128766601-128766623 TCAGGCCTCCCCGCCCTGCCTGG + Intronic
1091178710 11:133583857-133583879 TCACTTCTCCCCTCCCCACCAGG - Intergenic
1091558254 12:1592571-1592593 TCAGTCCTCCACCCCCTGCAGGG + Intronic
1093500534 12:19806696-19806718 TCACTCCCTCACTCCCTGGCAGG - Intergenic
1094480172 12:30875170-30875192 CCAGCCCTCCCCTCCCTGCCTGG - Intergenic
1094566206 12:31600447-31600469 TCACCCCTCCCCTGCCTGCTAGG - Intergenic
1094626897 12:32132827-32132849 TCACTCTTCCACTGTCTGCAAGG - Intronic
1095107972 12:38258581-38258603 TGACTTATCCACTGCCTGCCAGG + Intergenic
1095157647 12:38878023-38878045 TCACTGCTACACTCCCACCCGGG + Intronic
1096156031 12:49342106-49342128 TCCCTCCTGCACTCCCTCCCCGG + Intergenic
1096863822 12:54549558-54549580 TCTCTCCTCCTCCCCCGGCCGGG - Exonic
1097029459 12:56080673-56080695 TCCCTGCTCCCCTCCCTGCAGGG - Intronic
1099335203 12:81347563-81347585 TCACCCCTCGAAGCCCTGCCAGG - Exonic
1101287199 12:103327075-103327097 TACCTCGTCCCCTCCCTGCCAGG - Intronic
1101492558 12:105222837-105222859 TCCTTCCTCCTCTCCCTTCCTGG - Intronic
1101749941 12:107575298-107575320 TCACTCATCTTCTCCCTGCCAGG - Intronic
1101925968 12:108971652-108971674 TCACTTCTCCACTCCCCTACTGG - Intronic
1102031381 12:109741894-109741916 GCACCCAGCCACTCCCTGCCTGG + Intronic
1102041514 12:109803974-109803996 GCACCCCTCCACTCCCTTCTAGG - Intronic
1102047024 12:109835715-109835737 TCACTCCTCCACTCTCAACCTGG - Intergenic
1102419428 12:112792194-112792216 CAACTCCTCCCTTCCCTGCCGGG - Exonic
1102604601 12:114058741-114058763 GGACACCTCCACTCCCTCCCTGG + Intergenic
1103025704 12:117572072-117572094 GCTCTCCCCCAGTCCCTGCCTGG + Intronic
1103838178 12:123840893-123840915 TTGCTCCTCCTCTCTCTGCCTGG - Intronic
1103895535 12:124270737-124270759 ACACTCATCTTCTCCCTGCCGGG - Intronic
1104931406 12:132341270-132341292 ACCCTCCTCCAGTCCCTGCCTGG - Intergenic
1104973704 12:132542707-132542729 TATCTCCTCCCCACCCTGCCTGG + Intronic
1105298950 13:19116481-19116503 GCACTCCTACTCTCCCTTCCCGG + Intergenic
1107008458 13:35642598-35642620 TCACTCATCTATTCCCTGTCTGG - Intronic
1107061656 13:36166077-36166099 TCTCTCCATCACTGCCTGCCTGG + Intergenic
1107359519 13:39603324-39603346 GCACCCCCCCACTCCCTTCCCGG - Intronic
1107733989 13:43376894-43376916 TCACCCCTCCACACCTTGCTTGG + Intronic
1108095643 13:46897909-46897931 TCACTCCGCATCCCCCTGCCCGG + Intergenic
1108437698 13:50416956-50416978 TCACTGCTCCACACCATGCTGGG - Intronic
1109300489 13:60585512-60585534 TCACGTCTCCACTTCCTTCCCGG + Intergenic
1109677808 13:65702651-65702673 TCACCCCGCCACTCCTTGCTTGG + Intergenic
1111320945 13:86628246-86628268 TCCCTCCTCCACTCAATGCTTGG + Intergenic
1111759811 13:92447771-92447793 TCACTTCTGCACGCCCTGCAAGG - Intronic
1112013575 13:95312454-95312476 TCACTTCCCCACTCCCTGGTGGG + Intergenic
1112567827 13:100566411-100566433 TCACTCCTCAGCACTCTGCCTGG + Intronic
1112985250 13:105441193-105441215 TCACTTTCCCACTCCCTGTCTGG + Intergenic
1113025676 13:105938447-105938469 TCACTCAACCACTGCCTCCCAGG - Intergenic
1113035688 13:106046283-106046305 TCACTCCACCTCTGCCTCCCGGG + Intergenic
1113512922 13:110870111-110870133 TCACTCCTCACCTCCGTGACAGG + Intergenic
1113535425 13:111062512-111062534 TCACTGCTCCACTCCTCCCCAGG + Intergenic
1114473161 14:22977636-22977658 TCACTCCCCCAGTTTCTGCCTGG - Intronic
1116354336 14:43909184-43909206 TTACTCCCCCACTCCCTGACAGG + Intergenic
1118156285 14:63245545-63245567 TCCCTCCTCAGCCCCCTGCCAGG - Intronic
1118312882 14:64705941-64705963 GCTGTCCTCCACTCCCTTCCTGG + Intronic
1118820336 14:69341455-69341477 TCACTCATCAAATTCCTGCCTGG - Intronic
1119439526 14:74619017-74619039 CCACCCCTCCACCCCCAGCCAGG - Intergenic
1119605563 14:76013333-76013355 TCAAAGCTCCAGTCCCTGCCTGG - Intronic
1119633303 14:76253061-76253083 TCACTCTTCCATTGCCTCCCTGG + Intronic
1121007942 14:90502195-90502217 TCCTTCCTCCCCTCCCAGCCAGG + Intergenic
1121193169 14:92047521-92047543 GGACACCTCCACTCCCTCCCTGG - Exonic
1121217019 14:92256098-92256120 TCACATCCCCACTCCCTGCCAGG + Intergenic
1121519648 14:94577267-94577289 TCACTCCTCTCCACCCAGCCAGG + Intronic
1122945662 14:105007625-105007647 TCACAACTCCCCTCCCTGCTTGG + Intronic
1202923387 14_KI270724v1_random:4149-4171 ACCCTCCCCCAGTCCCTGCCTGG + Intergenic
1123457219 15:20436987-20437009 TCCCTCCTCCCCTCCATCCCAGG - Intergenic
1123660839 15:22563372-22563394 TCCCTCCTCCCCTCCATCCCAGG + Intergenic
1123715604 15:23028159-23028181 TCACACCTGCAATCCCAGCCTGG + Intronic
1123780256 15:23620023-23620045 TCTTTCTTCCACTGCCTGCCTGG + Intronic
1124187188 15:27541429-27541451 TCTCTCCTTCCCTTCCTGCCTGG - Exonic
1124218000 15:27825477-27825499 TCTCCCCGCCACTCCCAGCCGGG - Intronic
1124263372 15:28212136-28212158 TCCCTCCTCCTCTCCATCCCAGG - Intronic
1124314641 15:28657610-28657632 TCCCTCCTCCCCTCCATCCCAGG + Intergenic
1124374983 15:29124127-29124149 GCCCTGCTCCACTGCCTGCCAGG + Intronic
1124597450 15:31102648-31102670 TCACTCCCCCACCCAATGCCTGG + Intronic
1125970417 15:43906923-43906945 TCATTTCTCAAGTCCCTGCCAGG + Intronic
1126099655 15:45111683-45111705 TCTCCCCTCCAGGCCCTGCCAGG + Intronic
1126103876 15:45135354-45135376 TCTCCCCTCCAGGCCCTGCCAGG - Intronic
1126142573 15:45450165-45450187 TCCCTTCTCCTGTCCCTGCCTGG + Intergenic
1127040621 15:54972318-54972340 GCACTCATCCCCTCCCTACCGGG + Intergenic
1128607325 15:69046801-69046823 TCTCTGCTCTACTCCCTGCAGGG + Exonic
1128869941 15:71147031-71147053 TGACCCCTCCTCTTCCTGCCAGG + Intronic
1129172562 15:73817098-73817120 TCACTCCTCCCATCCCATCCAGG - Intergenic
1129193818 15:73952727-73952749 CCTCTTCTCCCCTCCCTGCCTGG - Intergenic
1129303928 15:74644504-74644526 TCCCTCCCCCACACCCTGACAGG - Intronic
1130940758 15:88506851-88506873 TCTCTCCTCCCATCCCTGCTTGG - Intergenic
1131060338 15:89400260-89400282 TCCCCCCTCCACCCCCTCCCCGG - Intergenic
1131265452 15:90912689-90912711 CCCCTCCTGCCCTCCCTGCCAGG - Intronic
1131530636 15:93188598-93188620 TCACTCCTTCTCTCCATTCCTGG - Intergenic
1132238755 15:100241283-100241305 TCATTCCACCACACCCTGGCAGG + Intronic
1132688751 16:1172979-1173001 CCACCCCTCCCCTCCCTCCCAGG - Intronic
1133213107 16:4273783-4273805 TCCACCCTCCCCTCCCTGCCGGG - Intergenic
1133354991 16:5129656-5129678 TAACACCTCCCCTCCCTGCGTGG + Intergenic
1134175191 16:12000237-12000259 TCACACCTCCACTGTGTGCCAGG + Intronic
1134216322 16:12319617-12319639 TCACTACCTCACTCCTTGCCAGG - Intronic
1134387092 16:13783575-13783597 TCACTCCTCCTCTCCCTTGAGGG - Intergenic
1135506972 16:23047428-23047450 TAACTTCTCCACTGACTGCCTGG + Intergenic
1135828050 16:25747823-25747845 TCTCTCCTCCTATCCCTCCCAGG - Intronic
1135973611 16:27090213-27090235 GCACTCCTCCCCTCCCAGCCAGG + Intergenic
1136030499 16:27499355-27499377 CCACTCCACCTCTCCCTGCTGGG - Intronic
1136034505 16:27528953-27528975 TCACCCCTGCACACCCTTCCAGG - Intronic
1136160196 16:28414940-28414962 ACACTCCTCCTCTCCCTCCTTGG - Intergenic
1136202892 16:28700350-28700372 ACACTCCTCCTCTCCCTCCTTGG + Intronic
1138054151 16:53814827-53814849 TCACTCCCCGACTCTGTGCCAGG + Intronic
1140972157 16:80023856-80023878 TCCCTTCTCCTCTCCCTCCCTGG + Intergenic
1141826335 16:86483265-86483287 TCACTCCTCCACCTCCTGAGTGG + Intergenic
1142883490 17:2898412-2898434 TCCCTCCCCCACACTCTGCCAGG + Intronic
1143265180 17:5631272-5631294 TCACTCCACCTCTCCTTACCAGG - Intergenic
1143335190 17:6166899-6166921 TCACTTCTCCACTCACCTCCTGG + Intergenic
1143681669 17:8480525-8480547 CCCCTCCTCCTCTCCCCGCCAGG - Exonic
1144889663 17:18487401-18487423 TCACTCCTCGATTTCCAGCCTGG - Intronic
1145142548 17:20456895-20456917 TCACTCCTCGATTTCCAGCCTGG + Intronic
1145791247 17:27628640-27628662 CCTCTGCTCCACACCCTGCCTGG - Intronic
1145806812 17:27740178-27740200 CCTCTGCTCCACACCCTGCCTGG - Intergenic
1145936671 17:28718233-28718255 TCCCTCCTCAACTCCAGGCCTGG + Exonic
1146809206 17:35890040-35890062 CCTCTCCTCCCCTCCCTTCCTGG + Intergenic
1147164034 17:38584077-38584099 TCTCTCATGCCCTCCCTGCCTGG - Intronic
1147887053 17:43691195-43691217 TCACTCCCTCAGCCCCTGCCAGG - Intergenic
1147987812 17:44316363-44316385 TGACTCCTCCTCCCCCTCCCAGG + Exonic
1148581431 17:48746818-48746840 CACCTCCTCCACTCCCTTCCTGG - Intergenic
1148744280 17:49909799-49909821 TCACTCTACCAGTGCCTGCCTGG - Intergenic
1151081786 17:71337558-71337580 TCACTTCTCAACTCGGTGCCAGG + Intergenic
1151402317 17:73863896-73863918 TCCCTCCTGCACCCCCAGCCAGG + Intergenic
1151420097 17:73991337-73991359 TGAGTCCACCACTTCCTGCCAGG - Intergenic
1151828151 17:76535105-76535127 CCACACTTCCATTCCCTGCCAGG - Intronic
1152120371 17:78414703-78414725 TCACTCTTCCACCCCCACCCCGG - Intronic
1152209944 17:78997653-78997675 TGACTCCTCTCCTCCCTCCCTGG - Exonic
1152256483 17:79242933-79242955 TTACTCCTCCTCTGCCTGCGTGG + Intronic
1152382983 17:79951854-79951876 TCTCCCCACCACCCCCTGCCCGG + Intronic
1152407369 17:80105243-80105265 TCACACCTCCGCTCCCAGCAAGG - Intergenic
1153027987 18:688486-688508 TTACTCCTTGGCTCCCTGCCAGG + Intronic
1154318499 18:13325470-13325492 ACACACCTCCCCTCGCTGCCCGG + Intronic
1155837445 18:30603809-30603831 CCAGTCCCCCACTCCCTGACAGG + Intergenic
1156316265 18:35972002-35972024 CCAATCCTCCTCTCCCTCCCAGG - Intergenic
1157260035 18:46169616-46169638 TCACTCCTCCAGAGCCTGCAAGG + Intergenic
1159130629 18:64276899-64276921 ACACTCCCCCACTTCCTTCCTGG - Intergenic
1160087738 18:75794215-75794237 TCCCTACCCCACTCCCTGACAGG + Intergenic
1160441056 18:78892859-78892881 TTCCTCCTTCACTCCCTGCCCGG - Intergenic
1160940855 19:1619853-1619875 TCACGTCCCCACTCCCTTCCAGG - Exonic
1160963868 19:1737041-1737063 ACGCGCCCCCACTCCCTGCCTGG - Intergenic
1161055570 19:2189248-2189270 TCACTCCTCCTGCACCTGCCCGG + Intronic
1161064168 19:2229377-2229399 CCAGTCCTCCTCTCCTTGCCCGG - Intronic
1161303174 19:3552925-3552947 GCACTCCTCTCCTCCCAGCCTGG + Intronic
1161632359 19:5364663-5364685 TCTCTTCTCCACTCCTTCCCCGG + Intergenic
1161756068 19:6135286-6135308 CCACTCCCAGACTCCCTGCCTGG + Intronic
1162141676 19:8589203-8589225 TCCCTCCCACACTCCCTGCATGG - Intronic
1162256461 19:9494085-9494107 TCACACCACCACTCCCAGCCTGG + Intronic
1162315189 19:9934507-9934529 CTTCTCCTCCACTCCCTGCTAGG - Intronic
1163226377 19:15964244-15964266 TGACCTCTCCTCTCCCTGCCTGG + Intergenic
1163228070 19:15979108-15979130 TCCCTCCTCCACTGTGTGCCCGG - Intergenic
1163765325 19:19160589-19160611 TCACTTCTCCTTTCCCGGCCTGG - Intronic
1164495237 19:28754483-28754505 TCTCTCCTAGAGTCCCTGCCTGG + Intergenic
1164935511 19:32207488-32207510 TCCTTCTTCCACTTCCTGCCTGG - Intergenic
1165330515 19:35139087-35139109 TCCCAACTCCACACCCTGCCAGG - Exonic
1165387194 19:35517513-35517535 TCACTCTTCCACTCCCTGCAGGG - Intergenic
1165956288 19:39503838-39503860 TCACTCCTCCACTTCCTAGGTGG + Intronic
1166123932 19:40702556-40702578 TCCCTCCTTCCCTCCCTCCCAGG - Intronic
1166422750 19:42651529-42651551 TCCCTTCTCTCCTCCCTGCCTGG - Intronic
1166446122 19:42858298-42858320 TCTCTTCTCTCCTCCCTGCCTGG + Intronic
1166453506 19:42920449-42920471 TCTCTTCTCTCCTCCCTGCCTGG + Intronic
1166455995 19:42939760-42939782 TCTCTTCTCTCCTCCCTGCCTGG + Intronic
1166465785 19:43029029-43029051 TCTCTTCTCTCCTCCCTGCCTGG + Intronic
1166483061 19:43189056-43189078 TCTCTTCTCTCCTCCCTGCCTGG + Intronic
1166772767 19:45294311-45294333 TCACCCCCTCACTCCCTTCCTGG + Intronic
1167015702 19:46839653-46839675 TCACTCCTTCACTCCATACGTGG + Intronic
1167383207 19:49150203-49150225 TCACTGCTCCACGCGCTGCCCGG + Intronic
1167607411 19:50488829-50488851 TCACTTCTGCTCTCCCTGTCCGG - Exonic
1167744564 19:51342918-51342940 AGTCTCCTCCATTCCCTGCCAGG + Intergenic
1167843067 19:52138221-52138243 TCCATCCTCTACTCCCTCCCTGG + Intronic
1168210844 19:54888918-54888940 TCACGCCACCACGCCCGGCCAGG - Intronic
925118143 2:1397739-1397761 TCCATCCTCCTCTCTCTGCCTGG + Intronic
926113575 2:10197316-10197338 TGTCTCCACCTCTCCCTGCCTGG + Intronic
926205389 2:10831613-10831635 CCTCGCCTCCACACCCTGCCTGG + Intronic
926407685 2:12571430-12571452 TGACTTCTCCCCTCCTTGCCAGG + Intergenic
926892598 2:17650758-17650780 TCACCCATCAACTCCCTGCCTGG + Intronic
927218008 2:20680670-20680692 TGACTTCTCCACTCCTTCCCTGG + Intergenic
927501681 2:23587502-23587524 TCCCCCCTCCACTGCCTGGCAGG + Intronic
927844072 2:26462303-26462325 CCACTCCTCCAGCCCCAGCCTGG - Intronic
928436360 2:31257127-31257149 ACCCTCCACAACTCCCTGCCAGG - Intronic
930096656 2:47570961-47570983 TGACTCCGCCTCTCCCTGCCGGG - Intergenic
931295947 2:60926134-60926156 TCCCTCCTCCTTTCTCTGCCAGG + Exonic
932833209 2:75010564-75010586 TCATCCCTCAATTCCCTGCCGGG - Intergenic
933774959 2:85766332-85766354 TCCCTCCCCCACACCCAGCCCGG + Intronic
933871111 2:86566341-86566363 ACCTTCCTCCACACCCTGCCAGG - Intronic
934613218 2:95755897-95755919 TCTCCCCTGCACACCCTGCCTGG + Intergenic
934708985 2:96503129-96503151 TCACTCCTCCATCCACTTCCTGG + Intronic
934897587 2:98132277-98132299 TGCCTTCTCCACTCCCTGCCTGG + Intronic
934950189 2:98570720-98570742 TCCCTCCTTCCCTCCCTGCAAGG - Intronic
935323332 2:101909937-101909959 TCACTTCTCCTCCCCCTACCTGG + Intergenic
937394067 2:121519311-121519333 TCACTCCTCATGTCACTGCCTGG - Intronic
937876136 2:126826869-126826891 TCTCTACTCCACTGCCTGTCTGG + Intergenic
938093757 2:128448847-128448869 TCCCACCTGCACTCCCTGCAGGG - Intergenic
938289003 2:130139819-130139841 TCCCTTCCCCACTCCCTCCCTGG + Intronic
938375058 2:130799453-130799475 TCTCTCCCCCACGCCCTGTCAGG + Intergenic
938467526 2:131533119-131533141 TCCCTTCCCCACTCCCTCCCTGG - Intronic
939872777 2:147543346-147543368 TCCCACCTACATTCCCTGCCTGG + Intergenic
940183810 2:150961207-150961229 GGACACCTCCACTCCCTCCCTGG + Intergenic
940945715 2:159615668-159615690 CTGCTCCCCCACTCCCTGCCGGG - Intronic
941067476 2:160919494-160919516 TTCCTCCTCCATTCCCTGACAGG - Intergenic
941159340 2:162018300-162018322 TCACTTGGCCACTCCTTGCCTGG + Intronic
942504374 2:176626277-176626299 CCACACCTCCACCCCCTCCCAGG + Intergenic
943147629 2:184065603-184065625 TGACTCCTGCACCTCCTGCCTGG - Intergenic
948263689 2:236622461-236622483 CCACACCTCCACTGCCTCCCAGG - Intergenic
948321904 2:237076463-237076485 TCACTCCCTCACTGCCTGGCTGG + Intergenic
948681039 2:239634855-239634877 TCACTCCCCACCTCCCTGCTGGG - Intergenic
948990236 2:241550397-241550419 CCACTCTTCCAGACCCTGCCAGG + Intergenic
949025144 2:241764224-241764246 TCCCTGCTGTACTCCCTGCCTGG + Intronic
1169132324 20:3172768-3172790 CCCCTCCTGCTCTCCCTGCCCGG - Intronic
1169139639 20:3220010-3220032 TCACTCCGTCACTCCATGGCTGG - Intronic
1169205938 20:3740428-3740450 TCTCTCCTCTACTCCCTCCCAGG + Intronic
1170365239 20:15591088-15591110 TCAATCCTCCTCTACCTGGCTGG - Intronic
1171272552 20:23828013-23828035 TGACACCCCCACTGCCTGCCAGG - Intergenic
1171501059 20:25593633-25593655 GCACTACTGCACTCCCAGCCTGG + Intergenic
1171849671 20:30299556-30299578 TCACTCCTCCACCCCCGGGGGGG - Intergenic
1172117828 20:32582857-32582879 TCAGCCCTCCCCACCCTGCCAGG - Intronic
1172119889 20:32592029-32592051 GCTCCCCTCCCCTCCCTGCCTGG - Intronic
1172469426 20:35180520-35180542 TCACTCCAGAGCTCCCTGCCAGG + Intergenic
1172843328 20:37915145-37915167 CCTCTCCTCCGCTGCCTGCCGGG - Intronic
1173158718 20:40636778-40636800 TAGCTCCTCCACTTCCTGCCAGG + Intergenic
1173652162 20:44673259-44673281 GGACACCTCCACTCCCTCCCTGG + Intergenic
1173884322 20:46444029-46444051 TCCCTCCTCCATTCCTGGCCAGG + Intergenic
1174248118 20:49197474-49197496 TCACTCCACCTCTGCCTGCCGGG + Intergenic
1175855487 20:62118736-62118758 TCACTGTCCCATTCCCTGCCCGG + Intergenic
1175914838 20:62420988-62421010 TCACTCCGCCCAGCCCTGCCTGG - Intronic
1175950756 20:62581934-62581956 CCACTCCTCCACGCCCCCCCAGG + Intergenic
1175962231 20:62642878-62642900 CCACTCCGACAGTCCCTGCCAGG - Intronic
1177757001 21:25360295-25360317 TGACTCCCCCACCCCCTGACAGG - Intergenic
1178945732 21:36946154-36946176 TCACCTCCCCATTCCCTGCCAGG - Intronic
1179008044 21:37531686-37531708 GCCCTCCTTCCCTCCCTGCCTGG + Intergenic
1179633480 21:42692792-42692814 CCTCTCCTCCACTCGGTGCCTGG + Intronic
1179635736 21:42707568-42707590 TCAATCCCCCACTCCCTCCCAGG + Intronic
1179713265 21:43275008-43275030 CCACCTCCCCACTCCCTGCCTGG + Intergenic
1179877285 21:44275499-44275521 TCCCACCTCCCCTCTCTGCCAGG - Intergenic
1180020121 21:45118635-45118657 TCTCTCCTTCTCTCCCTCCCTGG + Intronic
1180966106 22:19788689-19788711 TGACTCACCCACTCCCTTCCCGG - Exonic
1180970998 22:19815542-19815564 TCAGTCCTCCACTCCCCGCAGGG - Intronic
1181473402 22:23154306-23154328 TCAATCCTCCATGCCCTGCCTGG + Intronic
1181999530 22:26908988-26909010 TCACAAGTCCACTCCCTGTCTGG + Intergenic
1182557876 22:31138798-31138820 TCTCCCCTCCCCTCCCTGCAGGG - Exonic
1182733469 22:32513663-32513685 GCACTCTTCCCCTCCCAGCCTGG + Exonic
1183489268 22:38108094-38108116 CCCCGCCACCACTCCCTGCCGGG - Intronic
1184554732 22:45227038-45227060 TCACTCCTCCACTCCCTGCCCGG + Intronic
1184846747 22:47092414-47092436 TCATTCCTGCTCTCCCAGCCTGG - Intronic
1185154770 22:49186733-49186755 TCCCTCCTCCACCCACAGCCAGG - Intergenic
949220712 3:1630457-1630479 TCACTTCTCCACTTTCTTCCTGG + Intergenic
949559669 3:5189219-5189241 CAACTCCTCCACTCCCATCCAGG - Intronic
950583463 3:13878119-13878141 TCCCTCCCTCCCTCCCTGCCGGG + Intronic
950791594 3:15476753-15476775 TCAACTCTCCATTCCCTGCCAGG + Intronic
950950209 3:16991031-16991053 TCCCTCCTCCTCTCTCTGCAGGG - Intronic
952100106 3:30000880-30000902 TTAGTCCCCCACTCCCTGACAGG - Intronic
952296994 3:32070503-32070525 GGACACCTCCACTCCCTCCCTGG + Intronic
952553087 3:34501066-34501088 CCACTCTTACACTCTCTGCCTGG - Intergenic
952983676 3:38758761-38758783 CCACTCCCCCACTGCCTGGCTGG + Intronic
953656442 3:44858487-44858509 GGACACCTCCACTCCCTCCCTGG - Intronic
954228731 3:49199841-49199863 TCACTCCTCAACTCCAGGCGGGG - Intronic
956240555 3:67125497-67125519 TCACTCCTCTAATCCCAGCGTGG - Intergenic
956544311 3:70383235-70383257 TCACTCCTTCAGTCCCTAGCAGG + Intergenic
956784511 3:72631260-72631282 TCACTCATTCACTCCCTTCATGG + Intergenic
957085158 3:75670797-75670819 TCCCTCTTCCTCTCCCTTCCAGG - Intergenic
957288448 3:78246856-78246878 TCTCTCCTCCCCTCCCTGCCAGG + Intergenic
957574065 3:81986557-81986579 CCTCCCCTCCTCTCCCTGCCAGG + Intergenic
961388372 3:126537283-126537305 CCTGTCCTCCACTCCCCGCCAGG - Intronic
961892805 3:130144631-130144653 TCACTTGTCCTCTCTCTGCCTGG + Intergenic
962841511 3:139237249-139237271 TCACTGCTCCACTGCCTCCTGGG + Intronic
962921436 3:139953788-139953810 TCACTTCTCCACTCCCCTACTGG + Intronic
964207348 3:154189060-154189082 TCACTCCACCACGCCCTGGTGGG + Intronic
964416270 3:156451695-156451717 TCACTCCTGCCGTCCCTCCCTGG + Intronic
967053973 3:185811873-185811895 TCTCTCCCCCTCTCCCTGCCTGG + Intronic
967952217 3:194850089-194850111 CCACTCCTTCACTCCCTCCCCGG - Intergenic
968250983 3:197213394-197213416 TCAGCCCTCCACTCCCCACCAGG - Intronic
968705467 4:2075519-2075541 TGACTCCTTCCCTCCCTGCCAGG - Exonic
968705489 4:2075579-2075601 TGACTCCCTCCCTCCCTGCCAGG - Intronic
969345038 4:6564708-6564730 TCCCTGCTCCTCTCCCTTCCTGG - Intergenic
969437219 4:7195013-7195035 TCCCTCCTCAACTCTCTCCCAGG - Intronic
971824241 4:31599946-31599968 TACCTCCTCCACTCCCAGCAGGG - Intergenic
972943932 4:44229967-44229989 TCCCTCCCCCACCCCCTGACAGG + Intronic
974816425 4:67010694-67010716 CCAGTCCTCCACCCCCTGACAGG + Intergenic
975614592 4:76234117-76234139 TCCACCCTCCCCTCCCTGCCTGG - Intronic
976217601 4:82729776-82729798 TCTCTCCTCCCCTCTCTACCAGG + Intronic
978114419 4:105002582-105002604 TCACTCCAGAACTCCCTGCCAGG + Intergenic
978479179 4:109169264-109169286 CTACTCCTCCATTCTCTGCCTGG + Intronic
980463350 4:133146653-133146675 TCACTCCGCCGGTCCCTGGCTGG + Intergenic
982211507 4:153040247-153040269 TCTCTTCTCCACTTCCTTCCTGG - Intergenic
982301630 4:153884641-153884663 TAACTCCTCCTCTGCATGCCAGG - Intergenic
983648831 4:170018868-170018890 TCACTGCCCCACCCCCGGCCAGG - Intronic
983703112 4:170623083-170623105 TCCCCTCTCCCCTCCCTGCCTGG - Intergenic
984238545 4:177191457-177191479 GCACCCCACCACTCCCAGCCAGG - Intergenic
984709954 4:182876574-182876596 TCCCGGCCCCACTCCCTGCCAGG + Intergenic
985402002 4:189601918-189601940 TCATTCCTCCACGACCTCCCTGG - Intergenic
985570198 5:640723-640745 CCATGTCTCCACTCCCTGCCCGG + Intronic
985827778 5:2205370-2205392 TCTCACCTCCCCTCCGTGCCCGG - Intergenic
985946152 5:3185658-3185680 GCATTCCTTCACTCTCTGCCTGG - Intergenic
986000560 5:3627761-3627783 CCTCTCCTCCACTCCCTTTCGGG + Intergenic
986032446 5:3906767-3906789 TCACTCCTCATCTTCATGCCTGG - Intergenic
986044564 5:4024747-4024769 TCACTCTTGAACTCCCTTCCTGG - Intergenic
988444899 5:31274775-31274797 TCGCTACTGCACTCCCAGCCTGG + Intronic
988499398 5:31771815-31771837 TGGCTCCTTCACTCACTGCCTGG + Intronic
988974010 5:36497347-36497369 TCTCTCCTTCCATCCCTGCCTGG - Intergenic
990299647 5:54437600-54437622 TCACCCCGCCCCACCCTGCCAGG + Intergenic
991510059 5:67366114-67366136 TCACTCCTCCTTTGCCTGCCAGG - Intergenic
992555183 5:77896045-77896067 TCACTCTGCCACACCCTGGCCGG - Intergenic
994774360 5:104025090-104025112 TCACTCCTCCGTTGCCTCCCTGG - Intergenic
995142386 5:108748775-108748797 CCCCTCCTCCACTACCTCCCAGG - Intronic
995705574 5:114985794-114985816 TCACTCCTCTACTCCTCACCAGG + Intergenic
997177887 5:131797443-131797465 TCACACCTCCATTCCGCGCCGGG + Intergenic
997280631 5:132642035-132642057 CCACCCCTCCACTTCCTGCAGGG + Intronic
997435937 5:133875577-133875599 TCCCTCCTCCCCTCTCTACCAGG - Intergenic
997678693 5:135734178-135734200 GGACACCTCCACTCCCTCCCTGG - Intergenic
998148539 5:139744316-139744338 CCACTCCTCCAATCCTTCCCAGG + Intergenic
998575447 5:143310695-143310717 ACACTACTACACTCCCAGCCTGG - Intronic
999139463 5:149348548-149348570 TCCCTCCTCCACTCCTTGCTAGG + Intronic
999249429 5:150173351-150173373 TCACTCTGCTCCTCCCTGCCTGG + Intronic
999955240 5:156694030-156694052 TCACTCTTACATTCCCTGCCTGG + Intronic
1000439634 5:161250134-161250156 TGACCTCTCCACTCCTTGCCAGG + Intergenic
1001031885 5:168269213-168269235 TCCCTCCTCCACGACCAGCCAGG + Intergenic
1001303144 5:170552589-170552611 TCACTCCCCTTCTCCCTGACTGG - Intronic
1002193938 5:177492288-177492310 TCTGCCCTCCACTCCCGGCCAGG + Intronic
1002271936 5:178078258-178078280 TGACTCCTCCACTGCTGGCCTGG - Intergenic
1004290125 6:14359127-14359149 TCCCTTCTCCCCTCTCTGCCAGG + Intergenic
1005098677 6:22146215-22146237 TCCCTCCTGCTCCCCCTGCCTGG + Intergenic
1005445026 6:25914037-25914059 TCAGTCCTTCCATCCCTGCCTGG + Intronic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006332765 6:33404179-33404201 TCATGCCTCCCCTCCCTTCCAGG + Intronic
1006576091 6:35047544-35047566 TCACCCCTCCCCACCATGCCTGG + Intronic
1006743621 6:36326197-36326219 ACACTACTCCCCTCCCTGCCAGG + Intronic
1007112105 6:39318883-39318905 TCACTTACCCACTCCCTCCCTGG + Intronic
1007462439 6:42028244-42028266 TCTCTCTTCCACTCCTTCCCTGG - Intronic
1007959695 6:45947474-45947496 TCACCCCTCCATCCACTGCCTGG + Intronic
1008141758 6:47840033-47840055 TCACCCCTCCATCCCTTGCCTGG - Intergenic
1008591638 6:52999276-52999298 TCACTCCCCCACCCCCCGACTGG - Intergenic
1008657243 6:53628425-53628447 TCACTCCTCCACTTCCAGCAAGG + Intergenic
1009289778 6:61868323-61868345 GCAGACCTCCCCTCCCTGCCAGG + Intronic
1009789771 6:68386429-68386451 GCACTCTTCCAGTCTCTGCCTGG - Intergenic
1012497794 6:99853670-99853692 ACACTCCTCCACTCCCAGCTTGG + Intergenic
1012832285 6:104219306-104219328 TCAGCCCTCCACCCCCTGACAGG - Intergenic
1013019408 6:106197569-106197591 TCACTCCTCCACACCCAGGGAGG - Intronic
1014214396 6:118738743-118738765 CCACTCCTGCACTCTCTACCTGG + Intergenic
1014607563 6:123495740-123495762 TCATTTCACCACTGCCTGCCTGG - Intronic
1014693838 6:124594769-124594791 TCCCTCCTCTCCTCCATGCCTGG - Intronic
1015143112 6:129958116-129958138 TCACTCCTCCACTGTGTCCCAGG + Intergenic
1018176459 6:161182586-161182608 TGGTTCCTTCACTCCCTGCCAGG - Intronic
1018373003 6:163185961-163185983 GCCCTCCCCCACTCACTGCCTGG - Intronic
1018905499 6:168073293-168073315 TCCCTGCTCCCCACCCTGCCTGG + Intronic
1019395821 7:817002-817024 ACGCTCCTCCACGCCCAGCCCGG - Intronic
1019471731 7:1224758-1224780 TGACCCCTCCACTCCGTGCAGGG + Intergenic
1020083642 7:5299166-5299188 TGCCTCCCCCACCCCCTGCCTGG - Intronic
1021969480 7:25951755-25951777 TTAGTTCTCAACTCCCTGCCAGG - Intergenic
1022102949 7:27179978-27180000 TCTCTCCTTCTCTCTCTGCCCGG - Exonic
1022956848 7:35389090-35389112 TCACTCGCCCACTCACTTCCTGG - Intergenic
1023487436 7:40701858-40701880 TCTCTCCTTCACTCACTGTCTGG - Intronic
1024185676 7:46945875-46945897 TCCCTCCTCCTCCCTCTGCCTGG - Intergenic
1024291002 7:47803971-47803993 TCCCTTCTCCCCTCCCTACCAGG + Intronic
1024788168 7:52931965-52931987 TCACTCCAAGACTCTCTGCCCGG - Intergenic
1027174219 7:75893120-75893142 CCACTCCTCCTCTCTATGCCTGG + Intergenic
1029855404 7:103510482-103510504 TCCCTCCTCCACTCCCCGACAGG - Intronic
1030215949 7:107044470-107044492 TCCCTCCGCCTCTCCCGGCCCGG + Intergenic
1030348048 7:108455625-108455647 TCGCTTCTCCAGTCGCTGCCTGG - Intronic
1031052806 7:116961933-116961955 TCACCCCCCCACCCCCTGACTGG + Intronic
1032634987 7:133697052-133697074 TTACTCCTACACTCCATCCCTGG + Intronic
1034432632 7:151048767-151048789 TCTCTTCTCCTCTCCTTGCCTGG + Intronic
1035247890 7:157576779-157576801 TCCCTCCGCTCCTCCCTGCCAGG - Exonic
1035271430 7:157722314-157722336 TCAGGCCTCCCCTCCCTGGCGGG - Intronic
1036373036 8:8176850-8176872 TCACTTGTCCTCTCTCTGCCTGG - Intergenic
1036374470 8:8188400-8188422 TAACACCTCCCCTCCCTGCGTGG - Intergenic
1036876433 8:12477235-12477257 TAACACCTCCCCTCCCTGCGTGG + Intergenic
1036877869 8:12488791-12488813 TCACTTGTCCTCTCTCTGCCTGG + Intergenic
1039923107 8:41906805-41906827 TCACTCCTGGAGCCCCTGCCAGG + Intergenic
1039954889 8:42199602-42199624 TCAATGCTCCACCCTCTGCCTGG + Intronic
1042791217 8:72608305-72608327 TCCTGCCTCCTCTCCCTGCCTGG - Intronic
1043173447 8:76994677-76994699 CCACTCATGCACCCCCTGCCAGG + Intronic
1043482464 8:80667177-80667199 TCACTCCTCCCGTCACTCCCTGG - Intronic
1043512196 8:80960637-80960659 TCCATTCTCCACTCCCTGCTGGG - Intergenic
1045535637 8:103024905-103024927 CCTCTCCTCCACTGCCTACCTGG - Intronic
1047591255 8:126329849-126329871 TCACTTCTCCACTCCCCTACTGG - Intergenic
1047771914 8:128036731-128036753 TCACTCCTGCAATGCCTGACAGG - Intergenic
1048073176 8:131041622-131041644 TCCCTCCGCCACCCCCGGCCCGG - Exonic
1048499903 8:134966006-134966028 TCACTCCTCACCTTCTTGCCTGG + Intergenic
1049134727 8:140885871-140885893 TCACTCCTCCACTCAGAACCCGG - Intronic
1049266669 8:141671338-141671360 ACCCTCCTGCTCTCCCTGCCAGG + Intergenic
1050013543 9:1209426-1209448 TTTCTTCTCCACTCCCTCCCTGG - Intergenic
1050588102 9:7134065-7134087 TCCCTCTCCCCCTCCCTGCCAGG + Intergenic
1051790986 9:20802103-20802125 TCACTTCTTAACTACCTGCCTGG - Intronic
1051876839 9:21802598-21802620 TGACTCCTCCTCTTCCTCCCCGG - Exonic
1052348142 9:27430449-27430471 GCACTCCTACCCTCCCCGCCTGG - Intronic
1055397520 9:75891010-75891032 TCGCTGCTCTGCTCCCTGCCGGG + Exonic
1055517396 9:77047144-77047166 TCACTCCTCCTCTTCCTTCAGGG - Intergenic
1055591014 9:77813796-77813818 TATCTCCTCCCCTCCCTACCTGG - Intronic
1055697733 9:78905247-78905269 TCACTCCTCTCTTCCCTGGCAGG - Intergenic
1056289492 9:85128382-85128404 CCCATCCTCCACTCCCAGCCAGG - Intergenic
1056292762 9:85160503-85160525 ACACTCCTCCACTCCCGCGCTGG + Intergenic
1057083529 9:92189523-92189545 TCTCTCCTTCCCTCCCAGCCAGG - Intergenic
1057388095 9:94621998-94622020 TCTCGCCTCCACCCTCTGCCTGG - Intronic
1057422885 9:94926613-94926635 GCACTCCCCCACTCCCTGGACGG - Intronic
1058175245 9:101728351-101728373 TCACTCCTCTCCTCACCGCCAGG - Intronic
1059504199 9:114782989-114783011 TCATTCCTCCTCTCCCCACCTGG - Intergenic
1059656068 9:116358602-116358624 TAGCTCCTGCACTCACTGCCTGG + Intronic
1060040204 9:120293865-120293887 TCACTCAACCTCTCTCTGCCAGG + Intergenic
1060058267 9:120434678-120434700 TCAGTTCTCCTCTCCCTCCCTGG - Intronic
1060136312 9:121158706-121158728 TCACCCTTGCACTCCTTGCCTGG + Intronic
1060741350 9:126099583-126099605 CGCCTCCTCCACTGCCTGCCTGG - Intergenic
1061226074 9:129281692-129281714 TCAGCCCTCCACTCCCAGCGTGG - Intergenic
1061287947 9:129634896-129634918 TCACTCCTCCGATCCAAGCCTGG + Intronic
1061533851 9:131235567-131235589 TAACACCCCCACTCCCTGTCAGG + Intergenic
1061607083 9:131718718-131718740 TCTCCCCTTCACTCTCTGCCTGG - Intronic
1061851980 9:133421722-133421744 ACACACCTACACTTCCTGCCAGG - Intronic
1061990158 9:134154400-134154422 TCCCACCTCCTGTCCCTGCCTGG + Intronic
1062431299 9:136527934-136527956 CCACTCCCACCCTCCCTGCCAGG + Intronic
1185610907 X:1393016-1393038 TCCCGCCTCCTCTCCCTTCCCGG + Intergenic
1186789248 X:12981044-12981066 TCACTCCACCAGTTCATGCCAGG + Intergenic
1187442083 X:19329488-19329510 TCACTTCCACACTCCCTGACTGG + Intergenic
1187515023 X:19961050-19961072 TCCCTCCTCCTCTTCCTTCCTGG + Intronic
1188510197 X:30927627-30927649 TCCCTCCCCCACACCCTGACAGG - Intronic
1189176288 X:38960617-38960639 TCTCTCCATCCCTCCCTGCCTGG + Intergenic
1189957715 X:46292986-46293008 TCACTCCTCCACTCTCTTGTCGG + Intergenic
1190582834 X:51905154-51905176 TCAGTCCCCCACCCCCTGACAGG + Intergenic
1191004797 X:55699903-55699925 CCCCTTCTCCACTCCATGCCTGG + Intergenic
1192201786 X:69071032-69071054 TCAGTCCTGCTCTGCCTGCCTGG - Intergenic
1192908695 X:75580122-75580144 TCACACAAGCACTCCCTGCCTGG + Intergenic
1194017569 X:88643177-88643199 TGACTCCTCTACTCTCTGCTTGG - Intergenic
1195266009 X:103180553-103180575 TCCATCCTCCCCACCCTGCCTGG - Intergenic
1195698634 X:107685285-107685307 TCCCTCCTCCACTCCATAACCGG + Intergenic
1195738135 X:108034209-108034231 TCCATCCTCCTCTCCCAGCCAGG - Intergenic
1197038250 X:121904002-121904024 TCCCTTCTCCCCTCCCGGCCAGG + Intergenic
1197326910 X:125105660-125105682 TGACTTCACCTCTCCCTGCCTGG - Intergenic
1197479574 X:126966018-126966040 TCCCTGCTCCCCTCCCAGCCAGG + Intergenic
1197863291 X:130992783-130992805 TCACTGCTCAACTCCCCGACAGG - Intergenic
1198684350 X:139211826-139211848 TCACTCCAGAGCTCCCTGCCGGG + Intronic
1199794043 X:151178168-151178190 CCTCTCCCCCACGCCCTGCCCGG - Intronic
1200097981 X:153673140-153673162 TTCCTCCTCCACCCCCTGCCAGG + Intronic
1200176912 X:154123390-154123412 GCACTGCTCCACTCCCTGCATGG + Intergenic
1200238906 X:154483476-154483498 CCTCTCCTCCACTACCTGCGAGG + Intergenic
1201145683 Y:11064236-11064258 CCACCCCACCACTCCCTGCGTGG + Intergenic
1202026116 Y:20525705-20525727 TCACTTCTCCCCTCCCTGCTGGG - Intergenic