ID: 1184554855

View in Genome Browser
Species Human (GRCh38)
Location 22:45227607-45227629
Sequence AGTGACAGCCCGGTGACGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184554855_1184554858 6 Left 1184554855 22:45227607-45227629 CCTCACGTCACCGGGCTGTCACT No data
Right 1184554858 22:45227636-45227658 AAACGCTGCCAATACAATACTGG No data
1184554855_1184554859 9 Left 1184554855 22:45227607-45227629 CCTCACGTCACCGGGCTGTCACT No data
Right 1184554859 22:45227639-45227661 CGCTGCCAATACAATACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184554855 Original CRISPR AGTGACAGCCCGGTGACGTG AGG (reversed) Intronic