ID: 1184554877

View in Genome Browser
Species Human (GRCh38)
Location 22:45227715-45227737
Sequence CAGTGGGGCCCGTTCTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184554877_1184554884 -2 Left 1184554877 22:45227715-45227737 CCGGGAGAGAACGGGCCCCACTG 0: 1
1: 0
2: 2
3: 15
4: 112
Right 1184554884 22:45227736-45227758 TGAACTTCAGGGAAGGATCCTGG 0: 1
1: 0
2: 2
3: 29
4: 197
1184554877_1184554880 -9 Left 1184554877 22:45227715-45227737 CCGGGAGAGAACGGGCCCCACTG 0: 1
1: 0
2: 2
3: 15
4: 112
Right 1184554880 22:45227729-45227751 GCCCCACTGAACTTCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184554877 Original CRISPR CAGTGGGGCCCGTTCTCTCC CGG (reversed) Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
901357231 1:8661521-8661543 CAGTGGGGCACGATCACCCCGGG + Intronic
903950397 1:26993241-26993263 CAGTTCTGCCCGGTCTCTCCTGG - Intergenic
906284302 1:44576585-44576607 CACTGGGGCCCATCCTGTCCTGG - Intronic
907401164 1:54225791-54225813 CAGTGGAGCCTGTCCCCTCCCGG - Intronic
920370424 1:205475584-205475606 CTGTGGTGCCCGTTCTAACCTGG + Intergenic
920787028 1:209051427-209051449 CTGTTGGGCCCGATCTCTGCAGG + Intergenic
922201451 1:223404732-223404754 CAGTGGCCCCCTTTCTCTTCTGG + Intergenic
922226641 1:223651140-223651162 CAGTGGAGCCTGTTCTCACCAGG - Intronic
923659179 1:235943889-235943911 CACTGAGGCCAGTTCTCTTCCGG + Intergenic
924858722 1:247899621-247899643 CAGTGGGGGCCGTCCAGTCCTGG + Intergenic
1062816661 10:505941-505963 CAATGGGGCAGGTTTTCTCCTGG + Intronic
1063459954 10:6208917-6208939 TACTGGGGCCCGTTCCCTGCAGG - Intronic
1069349979 10:67513624-67513646 AAGTGAGCCCCATTCTCTCCAGG - Intronic
1069822199 10:71235017-71235039 CAGGGGGGCCCCTCCTCCCCCGG + Intronic
1070153519 10:73819571-73819593 CAGAGGGGGCTGTTCTGTCCCGG + Exonic
1072630295 10:97140727-97140749 CCGAGGAGCCCGTTCTCCCCTGG - Intronic
1076325408 10:129616772-129616794 CAGTGGGGCATGTTCTTTCCTGG - Intronic
1076380094 10:130019079-130019101 CAGTGGGGCCCCCACTCACCTGG + Intergenic
1076650342 10:131982575-131982597 CAGCGGGGCCCGTTGTGTCCGGG + Intergenic
1076679761 10:132165663-132165685 CAGAGGGACCCGGTCTCTCCTGG - Intronic
1077635355 11:3838319-3838341 CAATGGGGCCAGATCTCACCTGG + Intronic
1079028485 11:16967624-16967646 GAGTAGGGGCTGTTCTCTCCTGG - Intronic
1083592293 11:63902818-63902840 CGGTGGGGCCTGCCCTCTCCAGG + Intronic
1083615224 11:64022786-64022808 CAGTGAGGCCCCTGCTCCCCTGG - Intronic
1086106364 11:83151843-83151865 CAGTGTGGCCCATGCTCTCAAGG - Intergenic
1086371482 11:86159667-86159689 CAGTGGGGCCTGACCTCACCAGG + Intergenic
1087088282 11:94242261-94242283 CAGGGCAGCCTGTTCTCTCCAGG + Intergenic
1091788282 12:3256283-3256305 CAGCGGGGCCCGGCCTTTCCAGG - Intronic
1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG + Intergenic
1096007439 12:48184202-48184224 CAGTGGGGGACGTGATCTCCGGG + Exonic
1096195666 12:49647454-49647476 CAGTGGGACCCGCTAACTCCAGG + Intronic
1102966367 12:117130768-117130790 CAGTTGGGCCAGTGCTCTCTCGG - Intergenic
1104781037 12:131420678-131420700 CAGTGGGGCCCATGCACTCCAGG - Intergenic
1104979121 12:132565299-132565321 CAGAGGGGACTGCTCTCTCCTGG + Intronic
1105378515 13:19864795-19864817 CTGTGGGGCCCGCCCTCACCGGG - Intergenic
1108587488 13:51883183-51883205 CACTGGGCACCGTTCCCTCCTGG - Intergenic
1117008248 14:51444259-51444281 CAGTGGGGCCAGCACTCACCAGG - Intergenic
1119442885 14:74640585-74640607 CAGTAGAGCCCATTCCCTCCAGG - Intergenic
1119874084 14:78042266-78042288 CAATGGGGCCAGTTATCTTCAGG - Intergenic
1121440377 14:93945093-93945115 CAGTGGGGCTCCTTCTCTCCTGG + Intronic
1122089821 14:99330796-99330818 CAGGGGAGCCCGCTCTCTCCAGG - Intergenic
1130580575 15:85134085-85134107 CAGGGGCCCCCGTTCCCTCCTGG - Intronic
1132076316 15:98824158-98824180 CAGGGCTGCCCGTTCTCCCCAGG + Intronic
1133604549 16:7373458-7373480 AAGTGATGTCCGTTCTCTCCTGG + Intronic
1133824047 16:9261285-9261307 TGGTGGGGCCCAGTCTCTCCAGG + Intergenic
1134292308 16:12912180-12912202 AAGTGGGGCTCGCTCACTCCAGG - Intronic
1134827837 16:17298654-17298676 CAGTGGAGCCCCTTCCCTGCCGG - Intronic
1141755022 16:85985152-85985174 CAGTGAGGCCCCGTCTCCCCAGG - Intergenic
1142672338 17:1492903-1492925 GAGTGGGCCCCGTGCTCTCTAGG - Intergenic
1142931163 17:3284979-3285001 TAGTGAGGCGCTTTCTCTCCTGG + Intergenic
1143261052 17:5598447-5598469 CAGTGGGGCCAGTGCTTTGCAGG + Intronic
1144729360 17:17517788-17517810 GAGTGGGGGCCGCCCTCTCCTGG + Intronic
1147648769 17:42050344-42050366 CAGGGGAGCCCCTTCTCACCAGG - Intronic
1148856641 17:50582615-50582637 CACTGGGGCCAGACCTCTCCAGG + Intronic
1151331967 17:73415221-73415243 CTGTGTGGCCTGTTCTCACCAGG - Intronic
1151957324 17:77386855-77386877 AAGAGGGGTCAGTTCTCTCCAGG + Intronic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152895448 17:82908227-82908249 CATTGGGCCCCGTGCTCTCCTGG + Intronic
1153305142 18:3624203-3624225 CACAGGCGCCCGTTGTCTCCTGG - Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1161234461 19:3190950-3190972 TAGAGGGGCCGGTGCTCTCCAGG + Intronic
1161713957 19:5865150-5865172 GAGTGGGGCCCACGCTCTCCAGG - Intergenic
1163364616 19:16869095-16869117 CACGGGGCCCCGTTCTGTCCTGG + Intronic
1164825608 19:31282834-31282856 CGGTGAGGCCAGGTCTCTCCAGG - Intronic
1165294450 19:34915450-34915472 CAGAGTGGCCAGTTCTCTACAGG - Intergenic
1165393980 19:35553974-35553996 CAGTGGGGCCCAGGCTGTCCAGG - Intronic
1165811788 19:38616207-38616229 CTGTGGGGCTGGTTCTCTCCAGG - Exonic
1167433961 19:49468527-49468549 CAGTGCGGCCTGTCCTCTGCTGG + Exonic
1167718544 19:51160978-51161000 CACTTGGGCCTGTTCTGTCCAGG - Intergenic
1167981812 19:53282192-53282214 GAGTGGGGCCCTTCCTCTGCAGG + Intergenic
1167984280 19:53301470-53301492 GAGTGGGGCCCTTCCTCTGCAGG - Intergenic
1168161866 19:54515822-54515844 CACTGGGGCTGGGTCTCTCCTGG + Intergenic
926698217 2:15785254-15785276 CAGCGGGGGCCGTACCCTCCCGG + Intergenic
935292465 2:101621850-101621872 CACTGGAGCCAGTTGTCTCCTGG - Intergenic
939646950 2:144711786-144711808 CAGTGGAGCCAGTTCTGCCCAGG + Intergenic
942327889 2:174790929-174790951 GAGTGGGGCCAGTCCTCTCCTGG + Intergenic
947713807 2:232330136-232330158 CAGAGGGGCCCTTTCTCCCAGGG - Intronic
948460375 2:238127417-238127439 CAGTGGGGCCCGCCCCCGCCTGG - Intronic
1169896400 20:10509374-10509396 CAGTGGGGACGGTGCTCTGCTGG - Intronic
1173495099 20:43513137-43513159 CTGTGTGGCCAGTTGTCTCCAGG - Intronic
1173947172 20:46960850-46960872 CTGTGGGGCCCCTTCCCTGCTGG + Intronic
1174745184 20:53054959-53054981 CAGTGTGGTCAGTTCTCTCAAGG + Intronic
1175269327 20:57722785-57722807 CAGTGGGGTCTGTCCTCTTCTGG - Intergenic
1175541679 20:59751767-59751789 CAGTGGAGCCCGTTGTGCCCTGG + Intronic
1175966342 20:62661869-62661891 CAGAGGGGCCCGGGCCCTCCCGG + Intronic
1176000390 20:62828947-62828969 CCGTTGGGGCCCTTCTCTCCCGG - Exonic
1176218243 20:63958188-63958210 CAGTGGGGCCCCTTCTCCCTGGG + Exonic
1176414583 21:6467429-6467451 CGGTGGGGCCGGATCTCACCTGG + Intergenic
1179609946 21:42543754-42543776 CCGGGGAGCCGGTTCTCTCCTGG + Intronic
1179690081 21:43075751-43075773 CGGTGGGGCCGGATCTCACCTGG + Exonic
1179730560 21:43365103-43365125 CAGTGTGGCCCTGCCTCTCCAGG - Intergenic
1179828964 21:43984025-43984047 CTGTGGGGGCCGTGCTCTCAGGG + Exonic
1181544813 22:23596207-23596229 CTGTGAGGCCAGTTCTCCCCGGG + Intergenic
1181815493 22:25433655-25433677 CTGTGAGGCCAGTTCTCCCCAGG - Intergenic
1184398692 22:44260972-44260994 CAGTGGCACCCCTTCCCTCCCGG - Intronic
1184554877 22:45227715-45227737 CAGTGGGGCCCGTTCTCTCCCGG - Intronic
962662797 3:137621220-137621242 GAGTGGGGCACAATCTCTCCTGG - Intergenic
969289324 4:6228544-6228566 CAATGGGGCCCCTGCTGTCCTGG + Intergenic
971220655 4:24702840-24702862 CAGTGGGGCCAATTTTTTCCTGG + Intergenic
972237472 4:37150683-37150705 CAGTGGGTTCCCTTCTCGCCTGG + Intergenic
979303293 4:119111952-119111974 CAGTGGGCCACGTTCCCTCTAGG - Intergenic
985064256 4:186105345-186105367 CAGTGGGGACCCTGCTCTCTTGG + Intronic
993708315 5:91196298-91196320 CAGTTGGGCCAGTTGTCTCCAGG - Intergenic
1002182475 5:177437957-177437979 CAGTGGGCCTCATTATCTCCAGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1007737096 6:43988365-43988387 CAGGGGAGCCCCTTATCTCCTGG - Intergenic
1011026620 6:82876343-82876365 CAGTGGGGCCCATTGTTTACAGG - Intergenic
1014795028 6:125714894-125714916 GAGTGAGGCCCTATCTCTCCTGG + Intergenic
1016515988 6:144893483-144893505 CAGTGGGCCCTGTTTTCTCCAGG - Intergenic
1018848131 6:167569268-167569290 CAGTGGAGCCTGTTCTGACCGGG - Intergenic
1018940743 6:168307828-168307850 CAGTGGGCCACCTGCTCTCCTGG + Exonic
1018962105 6:168456448-168456470 CAGTGGGTTCCGTTCACACCAGG + Intronic
1019290962 7:249992-250014 CAGTGGGGACCTTGCTCTGCAGG - Intronic
1019444831 7:1065977-1065999 CGGCGGGGCCCCTGCTCTCCTGG - Intronic
1031974788 7:128086747-128086769 CAGCAGGGCACGTTCTCTCCAGG + Intronic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1035268349 7:157704686-157704708 CAGTGGTTCCTGTTCTGTCCTGG - Intronic
1035283064 7:157789322-157789344 CTGTTGGGCACGTTCCCTCCTGG + Intronic
1035742989 8:1943289-1943311 GAATGGGGCCCTGTCTCTCCTGG - Intronic
1036765933 8:11549370-11549392 CACTGGGGCCGGTTCCATCCAGG - Intronic
1049410149 8:142470264-142470286 GAGTGGGGCCGTTTCTCTCAAGG + Intronic
1051284292 9:15480178-15480200 CATTTGGGGCCATTCTCTCCAGG - Intronic
1053428975 9:38029261-38029283 CTATGGGGCCATTTCTCTCCAGG + Intronic
1060401983 9:123354729-123354751 CCTTGAGGCCTGTTCTCTCCAGG - Intergenic
1192850513 X:74951100-74951122 CACTGGGGCCTGTCATCTCCAGG - Intergenic
1195099293 X:101539202-101539224 CAGTGGGGACCATTCCCACCAGG - Intergenic
1198260470 X:134960565-134960587 CAGAGGGGCCCCTTGCCTCCCGG - Intergenic
1198834839 X:140794175-140794197 CAGTGTGGCCCTTCCTGTCCTGG + Intergenic
1200393740 X:155970248-155970270 CAGTGGGGGCTGTCCACTCCCGG + Intergenic