ID: 1184562272

View in Genome Browser
Species Human (GRCh38)
Location 22:45269930-45269952
Sequence GAGACTGTGAAAAGCGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184562272_1184562277 0 Left 1184562272 22:45269930-45269952 CCCTCCCCGCTTTTCACAGTCTC No data
Right 1184562277 22:45269953-45269975 TCCCTGTTCCCTTGTTCAGTTGG No data
1184562272_1184562286 8 Left 1184562272 22:45269930-45269952 CCCTCCCCGCTTTTCACAGTCTC No data
Right 1184562286 22:45269961-45269983 CCCTTGTTCAGTTGGGGTGGGGG No data
1184562272_1184562283 6 Left 1184562272 22:45269930-45269952 CCCTCCCCGCTTTTCACAGTCTC No data
Right 1184562283 22:45269959-45269981 TTCCCTTGTTCAGTTGGGGTGGG No data
1184562272_1184562284 7 Left 1184562272 22:45269930-45269952 CCCTCCCCGCTTTTCACAGTCTC No data
Right 1184562284 22:45269960-45269982 TCCCTTGTTCAGTTGGGGTGGGG No data
1184562272_1184562279 1 Left 1184562272 22:45269930-45269952 CCCTCCCCGCTTTTCACAGTCTC No data
Right 1184562279 22:45269954-45269976 CCCTGTTCCCTTGTTCAGTTGGG No data
1184562272_1184562282 5 Left 1184562272 22:45269930-45269952 CCCTCCCCGCTTTTCACAGTCTC No data
Right 1184562282 22:45269958-45269980 GTTCCCTTGTTCAGTTGGGGTGG No data
1184562272_1184562281 2 Left 1184562272 22:45269930-45269952 CCCTCCCCGCTTTTCACAGTCTC No data
Right 1184562281 22:45269955-45269977 CCTGTTCCCTTGTTCAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184562272 Original CRISPR GAGACTGTGAAAAGCGGGGA GGG (reversed) Intergenic
No off target data available for this crispr