ID: 1184562431

View in Genome Browser
Species Human (GRCh38)
Location 22:45270924-45270946
Sequence GCTCAGAGCAGTCAGGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184562431_1184562440 22 Left 1184562431 22:45270924-45270946 CCTACTACCTGACTGCTCTGAGC No data
Right 1184562440 22:45270969-45270991 CCCACTCCGTGCCCAACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184562431 Original CRISPR GCTCAGAGCAGTCAGGTAGT AGG (reversed) Intergenic
No off target data available for this crispr