ID: 1184565179

View in Genome Browser
Species Human (GRCh38)
Location 22:45287499-45287521
Sequence TGCCCCTGCTCTCCCTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184565179_1184565182 29 Left 1184565179 22:45287499-45287521 CCTGATGAGGGAGAGCAGGGGCA 0: 1
1: 0
2: 0
3: 32
4: 316
Right 1184565182 22:45287551-45287573 TTATATGCTGAGAACATCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184565179 Original CRISPR TGCCCCTGCTCTCCCTCATC AGG (reversed) Intronic
900256092 1:1698989-1699011 TCTCCCTGCTCACCCTCGTCTGG - Intronic
900264760 1:1751599-1751621 TCTCCCTGCTCACCCTCGTCTGG - Exonic
900781131 1:4617719-4617741 TGCCTGTGATCTCCCCCATCTGG + Intergenic
901552578 1:10006649-10006671 TGCCACTGCTCTCCCCAACCTGG + Intronic
902210020 1:14898270-14898292 TGCCCCTGCTCTCCTTTCTGTGG - Intronic
902406247 1:16185151-16185173 TGCCTCTGCTCTCCCTTGCCTGG - Intergenic
903444151 1:23410157-23410179 TGCCCCTGCACTCCCACAACAGG + Intronic
904612486 1:31733092-31733114 TGCCCCTGCTGGCGCTCACCTGG - Exonic
907300534 1:53483937-53483959 TGCCCCTGCTCTGCTGCACCTGG - Intergenic
908743598 1:67354245-67354267 CACACCTGCTCTCCCTCACCTGG - Intronic
913259916 1:116988670-116988692 TCCCCCTGCTCCCCCACAGCCGG + Exonic
913717147 1:121547759-121547781 ACCCCCTGCCCTCCCTCAACAGG + Intergenic
915543597 1:156583479-156583501 CTCCCCTGCTATCCCTCTTCTGG + Intronic
916285228 1:163098908-163098930 TGCCCTTGCTCTCCTACCTCAGG + Intergenic
918104371 1:181403865-181403887 TGGCCCTGCTCTCCTCCATGTGG + Intergenic
918180956 1:182085847-182085869 GCCTCCTGCTCTCCCTCAGCTGG + Intergenic
919745509 1:201006074-201006096 TGTCTCTGCCCTGCCTCATCTGG - Intronic
920364238 1:205439716-205439738 TAAGCCTGTTCTCCCTCATCAGG - Intronic
922464918 1:225839982-225840004 TGTAGCCGCTCTCCCTCATCAGG - Exonic
922789606 1:228304080-228304102 TGCCTCTGCTTCTCCTCATCAGG + Intronic
923109561 1:230879902-230879924 TCACCCTGCTCTCCCTCTGCTGG + Intergenic
923402942 1:233632815-233632837 TCCTGCTGTTCTCCCTCATCAGG + Intronic
1063234299 10:4096733-4096755 TGCCTCTGCACCCTCTCATCGGG + Intergenic
1063289826 10:4733924-4733946 TGCCACTGCCCTGCCTCATGGGG - Intergenic
1067045309 10:42982019-42982041 TGCCTCCCCTCTCCCTCACCAGG + Intergenic
1067497575 10:46773964-46773986 CGCCCCTGCTCTCTCCCTTCGGG - Intergenic
1067508858 10:46878415-46878437 TGGTCCAGCTCTCCCCCATCTGG - Intergenic
1067597076 10:47566451-47566473 CGCCCCTGCTCTCTCCCTTCGGG + Intergenic
1067653391 10:48173435-48173457 TGGTCCAGCTCTCCCCCATCTGG + Intronic
1068868387 10:61918446-61918468 TGACCCTGCCCTCCCTGGTCAGG + Intronic
1069867434 10:71512446-71512468 GGCTCCTGCTCTCTCTCATTTGG + Intronic
1070152506 10:73813524-73813546 TCCCCATGCTGACCCTCATCTGG - Exonic
1070261684 10:74862354-74862376 TGCCCCTCCTCTCCTTCAGCAGG + Intronic
1070373879 10:75810377-75810399 AGCCCCTGCCCTCCCTCAACTGG - Intronic
1071230443 10:83579862-83579884 TGCCCCTGCTGACCCTAAGCTGG - Intergenic
1071466187 10:85942031-85942053 TTCCCCTGCCCTCCGTCTTCAGG + Intronic
1072629324 10:97134624-97134646 TGGCTCTCCTCTCCCTCAGCAGG + Intronic
1072736325 10:97881954-97881976 AGCCCCTGCCCTCCCCCATCTGG + Intronic
1073199525 10:101723844-101723866 TGCCCCAGCTTTCCCTCACTAGG + Intergenic
1074112310 10:110431197-110431219 TGCCCCAGCTCTCCTTCCTCAGG - Intergenic
1075288554 10:121208608-121208630 TGCCCCTGCTCTTTTTCCTCAGG + Intergenic
1075335596 10:121606963-121606985 TGCTCTTGCTCTCCCTCTCCAGG + Intergenic
1075980259 10:126732381-126732403 TGCCGCTGCTCTTCATGATCTGG + Intergenic
1076186248 10:128451827-128451849 TGCACCTGCTGTCCCTCTGCTGG - Intergenic
1076702271 10:132280010-132280032 CGCCCCTGCACTCCATGATCAGG + Intronic
1077208370 11:1355002-1355024 TGCCATTGCTCTCCCTCCTGGGG + Intergenic
1077378078 11:2214967-2214989 TGCCTCTGCTCATCCTCCTCTGG + Intergenic
1077415265 11:2421774-2421796 TGTCCCTGCTCCCACTCACCTGG - Intronic
1078860850 11:15244802-15244824 TGCCCCTCCTCTCCCACCCCTGG - Intronic
1078944097 11:16044235-16044257 TACCTCTTCTCTCCCTCATTTGG - Intronic
1079735625 11:23993957-23993979 TGCCTCTGCTGTACCTCACCAGG + Intergenic
1080642288 11:34165003-34165025 TGCCCCTGCTCCCCCTCCCTGGG + Intronic
1081373883 11:42337006-42337028 TCCCTCTGCTCTCCCCCATGTGG + Intergenic
1081579852 11:44344770-44344792 TGCCCCTGCAGACCCCCATCAGG + Intergenic
1081675028 11:44963590-44963612 GGCCCCTGCCCTCCCACACCAGG - Intergenic
1081742463 11:45450043-45450065 TGGCCCTGCTCAGCCGCATCTGG - Intergenic
1081848478 11:46258307-46258329 TGTCCCTGATCACCCTCATCAGG - Intergenic
1081933212 11:46886897-46886919 TGCCCCTCCACTCCATCACCTGG + Intronic
1083593658 11:63909134-63909156 TGCCGCGGCTCTCTCTCAACGGG + Exonic
1083932700 11:65854679-65854701 AGCCCCTGCACACCCTTATCTGG - Exonic
1084329553 11:68422736-68422758 TGCCCCTACCCACCCTCACCTGG + Intronic
1084473649 11:69376903-69376925 TGACCCTGCTCTCACCCCTCTGG - Intergenic
1085878723 11:80440146-80440168 TGACCCTGCTATCCACCATCAGG - Intergenic
1087277848 11:96178323-96178345 TGCGCCTGCTCTCTCTCCACGGG - Intronic
1089625509 11:119748516-119748538 TCCCTCTGCTCTACCTCACCTGG + Intergenic
1089741897 11:120590250-120590272 TGCCTCTGCTTCCTCTCATCTGG + Intronic
1090774052 11:129947593-129947615 TGCCCCTTCTGTCCCACACCTGG + Intronic
1090958196 11:131532581-131532603 TGACCCTGCTCTTCCACTTCTGG - Intronic
1091240074 11:134046309-134046331 TGCCCCTGCTCCCCTTGCTCTGG + Intergenic
1091553120 12:1551890-1551912 TGCCCCACCTCTTCCTCACCTGG - Intronic
1092238860 12:6825569-6825591 TGCTGCTGCCCTCCTTCATCTGG + Exonic
1092290456 12:7157059-7157081 GGCCCCTCCTCTCCCTCACTGGG + Intronic
1092876820 12:12855953-12855975 TGGCCCTGCTCTCCCTGCTCGGG + Intergenic
1093061891 12:14616160-14616182 TTCTCCTCCTCTTCCTCATCTGG - Intronic
1094441741 12:30485545-30485567 TGCACCGGCCCTACCTCATCCGG + Intergenic
1095940902 12:47726131-47726153 TGCCCCTCCCCTGCCTCATAAGG - Intergenic
1096111003 12:49029136-49029158 GGCCCCTCGTTTCCCTCATCTGG - Exonic
1096229505 12:49889322-49889344 TTCCCCTCCTCCCCCTCATCAGG + Intronic
1096509333 12:52119014-52119036 GGCCCCTACCCTCCCTCACCTGG + Intergenic
1098890045 12:76000880-76000902 TGCCCCATCTCTCTCTCCTCAGG - Intergenic
1101703081 12:107193629-107193651 TGTCCCTGCTCCCTCCCATCTGG - Intergenic
1102506706 12:113388652-113388674 CGCCCCTGCTGACCCTCGTCAGG + Exonic
1102959648 12:117084531-117084553 TGGCCCTGGCCTCCCCCATCAGG + Intronic
1104908424 12:132227967-132227989 AGCCCCTGCTCAACCTCAGCAGG - Intronic
1105378745 13:19866850-19866872 TGCCACTGCACTCCAGCATCTGG + Intergenic
1105459187 13:20567418-20567440 TGCCCCTGCTTTTCTTCCTCAGG + Intronic
1107465784 13:40648812-40648834 TGCCCCTTCTATCTTTCATCAGG - Intronic
1107609908 13:42102662-42102684 TGTCTCTCCTCTCCCCCATCTGG - Intronic
1107664255 13:42672893-42672915 TGCCCCTGCTCCCTGTCAGCAGG - Intergenic
1113649472 13:112025959-112025981 TGCACCTGCTGCCCCTCCTCCGG + Intergenic
1114064963 14:19053086-19053108 AGCCCCTGCACACCCTGATCTGG - Intergenic
1114097298 14:19346916-19346938 AGCCCCTGCACACCCTGATCTGG + Intergenic
1114850376 14:26376303-26376325 AGTCCTTGCTCTGCCTCATCTGG - Intergenic
1119644922 14:76341257-76341279 GCCCCCAGCTCTCCCTCAGCTGG + Intronic
1121426616 14:93856710-93856732 TGCCCCTCCTTCCCCTCCTCAGG - Intergenic
1121990477 14:98552172-98552194 AGCCCCTGCCCTCCCTTATCAGG + Intergenic
1122419639 14:101567257-101567279 TGCACCTGCCCACCCCCATCGGG - Intergenic
1123626453 15:22230095-22230117 AGCCTCTGCCCTCCCTCAGCAGG + Intergenic
1124631353 15:31339397-31339419 TGCCCCCGCACTGCCTCACCAGG - Intronic
1127898416 15:63322776-63322798 TGCTTCTGCTCTCCCTGCTCTGG - Exonic
1128510588 15:68311660-68311682 GGCCCCTGCTCTCCGGCCTCAGG - Intronic
1129780215 15:78264878-78264900 CGCACCTTCTCGCCCTCATCCGG - Exonic
1130127782 15:81108476-81108498 AGCCCCTGCTCTTCCTCCTGAGG + Intronic
1131261697 15:90891101-90891123 TGCCCTGGCTCTCCCGCACCAGG - Exonic
1132762883 16:1519567-1519589 GGCCCCTGCACACCCTCAGCAGG + Intronic
1132879162 16:2153717-2153739 AGCCCCAGCCCTCCCTCACCTGG - Exonic
1133113629 16:3564072-3564094 AGCCCCGGATCTCCGTCATCCGG + Exonic
1133201421 16:4206754-4206776 TCCCCCTGATGTCCCTCCTCGGG + Intronic
1133238801 16:4402858-4402880 TGCCCCTTCTCTCCCAGCTCGGG + Intronic
1133516074 16:6510480-6510502 TGTGCCTGCTGTCCCTCACCTGG - Intronic
1133706434 16:8359239-8359261 AGCCCCAGCTCTTCCTCAGCTGG + Intergenic
1134090312 16:11388082-11388104 TGCCCCTGCTCCCTCTCTACTGG - Intronic
1134252491 16:12584048-12584070 TGCTCTTGCTCTTCCTCCTCAGG - Intergenic
1135026950 16:19006044-19006066 TGCCCCTGCCCATCCTCATCCGG + Intronic
1135953519 16:26937020-26937042 TGCCACTGCACTCCATCCTCGGG - Intergenic
1136024194 16:27459463-27459485 TGCCCACACTCTCCATCATCTGG + Intergenic
1136581146 16:31151571-31151593 TGCCCCCTCTCTGCCTCTTCAGG - Intergenic
1137694450 16:50452129-50452151 CACCCTTGGTCTCCCTCATCAGG + Intergenic
1138599683 16:58047103-58047125 TGCCCTGCCTCTCCCTCTTCTGG - Intergenic
1138891637 16:61150306-61150328 TGCCTCTGCTGTACCTCATCAGG - Intergenic
1141910611 16:87056291-87056313 TTCCCCAGATCTCCCTCATAGGG - Intergenic
1142235272 16:88919315-88919337 TGACCCTGGTCTCCTTCATTCGG + Intronic
1142279698 16:89141464-89141486 TACCCCTGCTCCACCTCCTCTGG - Intronic
1142287304 16:89176674-89176696 TGCTCCTGAGCTCCTTCATCTGG - Intronic
1142299142 16:89246676-89246698 TGCCCCCGCCCTCCCCCAACAGG - Intergenic
1142318215 16:89362991-89363013 TGACCCTGGTCTCCTTTATCCGG + Intronic
1142322390 16:89392176-89392198 TGACCCTGGTCTCCTTCATTCGG + Intronic
1142729564 17:1843411-1843433 TGCCTCTGCTCTCTCTCAGGTGG + Intronic
1142995123 17:3755448-3755470 TGCCCTTGCACTCCCTCCTCCGG + Intronic
1143019163 17:3907767-3907789 TGCTCTTGCTCTCCCTGATGGGG - Intronic
1143037664 17:4008954-4008976 AGCCCCTGCTCTCTCTCTGCAGG - Exonic
1143480780 17:7226313-7226335 TGCCCCTCCCCTCCCTCCACAGG - Exonic
1144670349 17:17129291-17129313 CTCCCCTGTTCTCACTCATCCGG + Intronic
1144771913 17:17764371-17764393 TGTCCCTTATCCCCCTCATCAGG + Intronic
1144957674 17:19027316-19027338 TGCCCCTACCCTGCCTCACCCGG - Intronic
1144977482 17:19147200-19147222 TGCCCCTACCCTGCCTCACCCGG + Intronic
1145259141 17:21344259-21344281 TGCCCTCCCTCTCCCTCCTCGGG + Intergenic
1145317477 17:21743744-21743766 TGCCCTCCCTCTCCCTCCTCGGG - Intergenic
1146926767 17:36750945-36750967 TGCCCATTCTCTCCCACAGCTGG - Intergenic
1147136754 17:38438524-38438546 CGCCCCTTCCCTCCCCCATCAGG + Intronic
1147198079 17:38780983-38781005 TACCCCTGCATTTCCTCATCAGG + Intronic
1147919195 17:43906098-43906120 TGGCGCTGCTCTCCCTCACAGGG + Intronic
1147988141 17:44318231-44318253 TGCCCATGCTGTTCCTCAGCTGG - Exonic
1148553276 17:48563551-48563573 TCCCACTATTCTCCCTCATCTGG + Intronic
1151029179 17:70715855-70715877 TGCCCATGCTCTCTCGCTTCAGG + Intergenic
1151676835 17:75603010-75603032 TGACCCCTCTTTCCCTCATCAGG + Intergenic
1152132340 17:78484891-78484913 TGGCCCCGCACACCCTCATCCGG - Exonic
1152180924 17:78821319-78821341 TCCCTCTGCTCTCCCTCAGCAGG - Intronic
1154123418 18:11669874-11669896 TCACCCTCCTCTCCCACATCAGG - Intergenic
1154127000 18:11700452-11700474 TGCCCTAGCTCTGCCTCATCAGG + Intronic
1155491812 18:26407371-26407393 TGTCCCTGCTGAACCTCATCAGG + Intergenic
1156486876 18:37471991-37472013 TGCTCCTGCTCTCCCTGGTTAGG + Intronic
1157690931 18:49681237-49681259 TACCCATGCTGTCCCTCACCTGG + Intergenic
1157826397 18:50815990-50816012 TGCCCCTGCACTCCAGCATGGGG + Intronic
1158072529 18:53490119-53490141 TGCCTCTGTTCTCCCTCAAATGG + Intronic
1160125628 18:76169191-76169213 TGTCCTTGCTCTCCCACCTCTGG - Intergenic
1160471622 18:79140188-79140210 GGCCCCTGCTCTACCTCACCGGG - Intronic
1160857809 19:1225159-1225181 TGCCCCAGCTCTGCATCAGCGGG - Intronic
1161356343 19:3821288-3821310 TGGACCTGCCCTCCCTCACCAGG + Intronic
1161445843 19:4318684-4318706 TGCCTGTGCCCTCCGTCATCTGG - Intronic
1162463833 19:10829419-10829441 TACCCCTTCTCTCCCTCCTCCGG - Intronic
1162696711 19:12482357-12482379 TGCCCCTGCCCTCTGTCACCAGG - Intronic
1162910955 19:13847578-13847600 TGGCCTCGCTGTCCCTCATCTGG - Intergenic
1163296163 19:16414170-16414192 TGCCCCTGTTCCCCCTCACGTGG - Intronic
1164493344 19:28735288-28735310 TGCCTGTGCTCACCCTCAGCAGG + Intergenic
1164759531 19:30718631-30718653 TTCCCCTGCCCTCCCTGCTCAGG - Intergenic
1165330721 19:35140022-35140044 TGCCCTTGCTCTCCCACATAGGG - Intronic
1165810072 19:38606825-38606847 TGGCCCTGCTCTCCCTGTGCTGG + Intronic
1166069703 19:40379845-40379867 AGCACATGCTCACCCTCATCAGG - Intronic
1166295415 19:41887105-41887127 TGCCTCTGTCCTCCCACATCTGG - Intronic
1166740601 19:45112672-45112694 TGCCCCAGCTCTACCTACTCTGG + Intronic
1167048711 19:47066497-47066519 TGCCCGTGCCCACCCTCTTCGGG - Exonic
1167125462 19:47545588-47545610 TGTCCCTGCCCCGCCTCATCGGG - Exonic
1167503267 19:49858861-49858883 TGCTCCTCCTCTGCCACATCAGG + Intronic
1167528051 19:49997570-49997592 TGCCCCTCCTGTCCCCCACCAGG - Exonic
1167749611 19:51371864-51371886 TGCCCCTGCCCTCTGTCCTCAGG + Intronic
1168168867 19:54573519-54573541 AGCCTCTGCTCACCCTCATCTGG + Intronic
1168196223 19:54775931-54775953 TGCCACTGCACTCCATCATAGGG - Intronic
1168349946 19:55669989-55670011 TGGCCCTGCTCCCCCTTATATGG + Intronic
1168469502 19:56629115-56629137 TTCTGCTGCTCTCCCTCAGCAGG + Intergenic
925425826 2:3748074-3748096 AGCTCCTGCCCTCCCTCACCAGG - Intronic
925876184 2:8312907-8312929 CTCACCTGCTCTCCCTCAGCAGG - Intergenic
926037895 2:9649343-9649365 TGCCCCTCCTCCCCCTCTCCAGG + Intergenic
926103432 2:10135478-10135500 TGCCCCTCCCCTCCCCCACCAGG - Intergenic
927515371 2:23668935-23668957 TGCCCCTGCTGTGCCACTTCCGG - Intronic
928280068 2:29938144-29938166 TCCCCCTGCCCTCCCTTCTCAGG - Intergenic
929291586 2:40198036-40198058 TTCCTCTGCTGTTCCTCATCTGG - Intronic
930500960 2:52216732-52216754 TTCCCTTGCTCTCCTTCGTCTGG - Intergenic
931669669 2:64636075-64636097 GACCCCTGCACTTCCTCATCAGG - Exonic
932751681 2:74375355-74375377 GGCCCCTGCTCTCACCCATGTGG - Intronic
933174262 2:79158502-79158524 TTGCCCTGCCCTCCCTCAGCAGG - Intronic
934756306 2:96827163-96827185 TGGCCCTGCTCTTGGTCATCTGG - Intronic
935579387 2:104743694-104743716 TGCCTTTTCTCTCCCTCCTCTGG - Intergenic
936017748 2:108972477-108972499 TGCCCCGGCACTCCCACAGCGGG - Intronic
937324032 2:120978394-120978416 TGGCCCTGCTTACCCTCTTCTGG + Intronic
939187825 2:138881247-138881269 TGCCCTTCCTCTCTCTCTTCTGG + Intergenic
943669930 2:190649268-190649290 GCCCCCGGCTCTCCCTCCTCTGG - Exonic
945408486 2:209480925-209480947 TTTCCCTGCTCTGCTTCATCTGG + Intronic
946040578 2:216780031-216780053 TGCCACTGTCCTCCCTCATCAGG - Intergenic
946902376 2:224384666-224384688 CGCCCCCACTCTCTCTCATCAGG + Intronic
948049617 2:234969693-234969715 TGCTCCTGCCCTGCCTCCTCTGG + Intronic
948088028 2:235266954-235266976 TGCCACTTCCCTTCCTCATCTGG - Intergenic
1168837482 20:887415-887437 TCCCCCAGCTCTCTCTAATCTGG - Intronic
1170138706 20:13103697-13103719 TGCCCCTGCTCCCTCTCCTATGG - Intronic
1171428131 20:25061268-25061290 TTCCTCTGCTCTCACTCATTGGG + Intergenic
1172607750 20:36225958-36225980 TGCCCCATCTCTCTCTCTTCTGG + Intronic
1173828415 20:46062368-46062390 TGGCCCTGCTCTCTCCCACCTGG - Exonic
1174449508 20:50610670-50610692 AGCCCCTGCTGTCCTTCAACTGG + Intronic
1176297200 21:5080439-5080461 TGCCCCTGCCCTGCCTCAGTGGG - Intergenic
1176861379 21:14013187-14013209 TGCCACTGCCCTCCATGATCCGG - Intergenic
1179767248 21:43582847-43582869 TGGCCCTCATCTCCCTCAACAGG - Intronic
1179767357 21:43583351-43583373 TGGCCCTCATCTCCCTCAACAGG - Intronic
1179771049 21:43617079-43617101 TGCTTCTGCTCTCCAACATCTGG - Intronic
1179859829 21:44181509-44181531 TGCCCCTGCCCTGCCTCAGTGGG + Intergenic
1180193929 21:46182514-46182536 TGCCCGTGACCTCCCGCATCAGG + Intronic
1180483452 22:15775706-15775728 AGCCCCTGCACACCCTGATCTGG - Intergenic
1181421338 22:22801157-22801179 TGCCCCTGCTCTCTCTCCCCAGG + Intronic
1181510166 22:23385479-23385501 TGCCCCTGCTGACCCTAAGCTGG + Intergenic
1182425259 22:30268178-30268200 TGCCCCAGCTCTCCTTGCTCAGG - Intergenic
1182638738 22:31750137-31750159 TCCCCCTGCACTTCCTCATCCGG + Intronic
1184135225 22:42544858-42544880 TGCCCTGGCTCTCCCACCTCTGG + Intergenic
1184315944 22:43689329-43689351 TGCACGTGCTCTCCCTCACGTGG - Intronic
1184521795 22:44998931-44998953 TGCCCCTCCCATCCCTCTTCAGG + Intronic
1184565179 22:45287499-45287521 TGCCCCTGCTCTCCCTCATCAGG - Intronic
1184894191 22:47397617-47397639 GTCCCCTGCTCTCCCTCACCTGG + Intergenic
1185122681 22:48981927-48981949 TGCACCTGCTCACTCTCAGCGGG + Intergenic
1185345149 22:50307690-50307712 CTCCCCTCCTCTCCCTCGTCGGG - Intergenic
950975683 3:17241027-17241049 TAACCATGTTCTCCCTCATCTGG + Intronic
951459333 3:22932443-22932465 TGGCCCTTCACTGCCTCATCTGG - Intergenic
952727161 3:36598143-36598165 TTCCCCAGATCTCCCTCTTCAGG + Intergenic
953060785 3:39427312-39427334 TGCCCCTGCTTTACCTCACATGG - Intergenic
953222480 3:40985452-40985474 CCTCCCTGCTCTCCCTTATCAGG - Intergenic
953769257 3:45766097-45766119 TGGCCCCGCCCTCCCTCCTCAGG - Intronic
953955037 3:47225316-47225338 TGCCACTGCTCTCCAGCATGAGG + Intergenic
954701161 3:52451587-52451609 TGTCCCTGCTCTGCCTCCTGGGG - Intronic
954939501 3:54358543-54358565 CGCCCCTGTTCTCCCTCTGCAGG - Intronic
955214413 3:56972938-56972960 AGTCCCTGCCATCCCTCATCTGG - Intronic
955916661 3:63913351-63913373 TGCCCCCTCCCTCCCTCCTCAGG - Intronic
956079991 3:65548303-65548325 TGCCCCTCTTGTCCCTCATTGGG - Intronic
960926622 3:122800822-122800844 TTCCCCTATTCTCCCTCATCAGG - Intronic
962076896 3:132091419-132091441 TGCACCTGCTTTTCCCCATCAGG + Intronic
962210500 3:133473411-133473433 TGCCTCTTCTCTCCCACTTCCGG - Intronic
964224562 3:154383216-154383238 TGCCCCAGTTCTCCCACAGCTGG - Intronic
965162522 3:165152587-165152609 TCCCCCTGCCCTCCCTCAACAGG + Intergenic
965539041 3:169853979-169854001 TGCCCATGCTCTCTCTCCCCAGG - Intronic
968552123 4:1229158-1229180 TGCCCCTGCCCTCCCTGGGCTGG - Intronic
968881913 4:3305282-3305304 TGCCCCTGCAGTCCCTCCACTGG - Intronic
969286733 4:6207187-6207209 GGCCCTTGACCTCCCTCATCTGG - Intergenic
969462506 4:7336215-7336237 GGCCCCTACTCTCCCTCACTGGG + Intronic
970483330 4:16499908-16499930 TGTCCCTGGTCTCCTACATCAGG - Intergenic
970612434 4:17738265-17738287 TGGCCCTGCTCTCCATCACATGG + Intronic
971727158 4:30328326-30328348 TGCTCCAGCTATGCCTCATCGGG - Intergenic
972675532 4:41256852-41256874 TGCCCCTGCTCCCCCTGCACAGG + Exonic
977479159 4:97552182-97552204 TGCCCATGTTCTCCCTGATATGG - Intronic
977876980 4:102161887-102161909 AGCTCTTGCTGTCCCTCATCAGG - Intergenic
978751769 4:112257245-112257267 TCGCCCTGTTCTACCTCATCTGG + Intronic
982066652 4:151660246-151660268 AGCCCCTGGTCTCCCTCACTGGG + Intronic
984200964 4:176720797-176720819 TGCCACTGCACTCCCCCACCTGG + Intronic
984633311 4:182083265-182083287 TTCCCCTGTTCTGCCTCATTAGG - Intergenic
984913761 4:184701123-184701145 GGCCCCTGCTTTCCTTCCTCTGG - Intronic
985127387 4:186708338-186708360 TACCCGTTCTCACCCTCATCAGG + Exonic
986004387 5:3656111-3656133 GGCCCCTGCTCTGTCTCCTCTGG - Intergenic
986966235 5:13275240-13275262 TCCTCCTTCTCTCCATCATCTGG - Intergenic
989432375 5:41370945-41370967 GACCCCTTCTCTCCATCATCTGG + Intronic
991177562 5:63707628-63707650 TGCCCCAGCTGTCCCTAATTAGG + Intergenic
991537014 5:67680606-67680628 TGCCTCTGCTCCCGCTCATAGGG + Intergenic
992396265 5:76372114-76372136 TGCCCCTGTCCTCCCTGCTCTGG - Intergenic
994165192 5:96600933-96600955 TGCCCCTGCTCCTCCTTCTCTGG + Intronic
995033446 5:107506558-107506580 TGCTCCTGCTCCTGCTCATCTGG - Intronic
995454652 5:112338481-112338503 TGCACCTGTGCTCCCTCACCAGG + Intronic
996932829 5:128911230-128911252 TCCCCCTGCCCTCCCCCAGCAGG + Intronic
997594239 5:135095600-135095622 GGCCCCTCCCCTCCCTCATTGGG + Intronic
999495134 5:152089368-152089390 TCCCACTCCACTCCCTCATCAGG + Intergenic
1000161329 5:158600549-158600571 TGCCCCTGTTCTCCCACAGCTGG + Intergenic
1002196630 5:177504799-177504821 TGCCCTTGGCCTCCCTCAGCTGG + Exonic
1002201174 5:177529315-177529337 TGCTCCTTCTCTCCCGCCTCAGG - Intronic
1002294303 5:178221670-178221692 TGTCCCTGCCCTTCCTCCTCTGG + Intronic
1003203429 6:3985603-3985625 TGCCCCTGATCTCCCACTACAGG + Intergenic
1003520775 6:6856768-6856790 TGCCTCTGCTCTCCCTCCCTAGG - Intergenic
1003564973 6:7215053-7215075 TCTGCCTTCTCTCCCTCATCTGG - Intronic
1004434285 6:15575800-15575822 TGCCCCATCTCTCCCTCTTCTGG - Intronic
1006929911 6:37681316-37681338 TGCCCCTGCCCCCCCTCTTCAGG + Intronic
1007318656 6:41010370-41010392 TGTCCCTCCTCTCCCTGAGCTGG + Intergenic
1010144793 6:72655547-72655569 TGCCCATGTTGTTCCTCATCCGG - Intronic
1010253234 6:73730095-73730117 GCCCACTGCTCTCCCTCAGCAGG - Intronic
1010654637 6:78497571-78497593 TCCTCCTACACTCCCTCATCAGG + Intergenic
1015603447 6:134932932-134932954 TGCCCCTGATCTCCTTCACCGGG - Exonic
1016657830 6:146542619-146542641 TGACCCAGCTATCCCTCTTCTGG - Intergenic
1017236550 6:152122550-152122572 TTCTCCTGCTCCTCCTCATCGGG - Exonic
1019161849 6:170074154-170074176 TGCCCCTGCTCAGCTGCATCTGG - Intergenic
1021925425 7:25529549-25529571 GGCCCCTGCTCTGCCTCGCCGGG + Intergenic
1022531349 7:31068827-31068849 TGACCTTGCTGTCACTCATCAGG + Intronic
1023039297 7:36158302-36158324 CACCCATCCTCTCCCTCATCAGG + Intronic
1023128296 7:36976662-36976684 GGCCCCTGCTCACCTCCATCAGG - Intronic
1023870385 7:44260251-44260273 TGCCAGTGCCCTCCCTCCTCTGG + Intronic
1025250859 7:57350473-57350495 TGCCCCTGCTGTCCCTCACTGGG + Intergenic
1027418752 7:77999565-77999587 TCTCCCTGCCCTCCCTCAACAGG - Intergenic
1029032246 7:97480875-97480897 TCTCTCTGCTCTGCCTCATCCGG - Intergenic
1029048327 7:97655740-97655762 TGTTCCTGCTCTTCCTCATTTGG - Intergenic
1029289460 7:99491064-99491086 TGCCCCAGCTCACCTACATCAGG + Intronic
1029669679 7:102020957-102020979 TGTTCCAGATCTCCCTCATCTGG - Intronic
1031890995 7:127293511-127293533 TAGCCCTGATCTCCCTGATCAGG + Intergenic
1031967548 7:128038029-128038051 TGCACCTGCTGGCCCTGATCTGG - Intronic
1034337488 7:150332884-150332906 TGCCCCTCCTATCCCTGCTCTGG - Intronic
1034419774 7:150983563-150983585 GGCCCCTTCTCTTTCTCATCTGG - Intergenic
1035636606 8:1151570-1151592 TGCCCCTCACCTCCCTCACCAGG - Intergenic
1036282540 8:7414128-7414150 TGGCCCTGCTCTCTCTCCTTGGG - Intergenic
1036338932 8:7897421-7897443 TGGCCCTGCTCTCTCTCCTTGGG + Intergenic
1036425991 8:8645753-8645775 TGCCTCTGCCTTCCCTCACCTGG + Intergenic
1038219323 8:25592626-25592648 TGCACCAGCTCTCACTGATCAGG - Intergenic
1039457106 8:37714821-37714843 TGCCTCTCCTCTCCCTCCACTGG + Intergenic
1045045676 8:98274899-98274921 TCCCTCTGCTCTCACTCTTCTGG + Intronic
1047346278 8:124031779-124031801 TGCCCCTGCCTTCCCTCAACTGG - Intronic
1049773547 8:144394596-144394618 TCCCCCGGCTCACCCTCACCCGG - Intronic
1053474157 9:38370033-38370055 GGCCCCTGCTCTCCAGGATCTGG - Intergenic
1055980484 9:81995425-81995447 AGCCCCTTCTCTCCCTGATGAGG + Intergenic
1056260192 9:84841066-84841088 TCCAGCTGCTCTCCCTCATATGG + Intronic
1056595812 9:88006938-88006960 TTCCCCTGCTCTGCATCCTCAGG - Intergenic
1057186683 9:93061103-93061125 AGCCCCAGCACTCCCTGATCTGG + Intronic
1057200140 9:93135324-93135346 TGCCCCAGCTCTGCCTCAGAGGG + Intergenic
1057353345 9:94317791-94317813 TGCCCGTGCTCTTCCTGATGAGG + Intergenic
1057654406 9:96939801-96939823 TGCCCGTGCTCTTCCTGATGAGG - Intronic
1058403921 9:104650044-104650066 TGACCCTGCAATCCCTCTTCTGG + Intergenic
1058888168 9:109338749-109338771 TCCCCCTGCTCACTCTCATTAGG + Intergenic
1059448759 9:114356862-114356884 AGCACCGGCTCTCCCACATCAGG - Exonic
1060144602 9:121240685-121240707 TGCCCCTCCTCTACCCCATGAGG - Intronic
1060219991 9:121759392-121759414 TGCCCCTGGGCTCCCCCATTAGG + Intronic
1060247334 9:121957657-121957679 AGCCCATGCCCTCCCTCCTCCGG + Intronic
1060931313 9:127491311-127491333 TGCCCCTGCCCTCCTTCACGTGG + Intronic
1060933358 9:127502752-127502774 TGCTCCCGCTCTCCCTCCCCAGG + Exonic
1061481392 9:130899105-130899127 TACCTCTGCCCTCCCTCCTCTGG + Intergenic
1061868113 9:133505891-133505913 TGCCCCTCCTCTCCTACCTCTGG + Intergenic
1062627095 9:137448290-137448312 CGCCCCAGCCCTCCCTCAGCTGG + Exonic
1185640159 X:1585824-1585846 TGCCTCTGCTCTAGCTCTTCTGG - Intergenic
1187439758 X:19307429-19307451 CTCCCTTGCTCTCCCTCTTCTGG - Intergenic
1189205827 X:39238004-39238026 TGCCTCTGCTATCACTCCTCAGG + Intergenic
1190261961 X:48802804-48802826 TGCTCCCTCTCCCCCTCATCAGG - Intronic
1190881882 X:54497170-54497192 TGAAACTGCTCTCTCTCATCAGG + Intergenic
1193912886 X:87327451-87327473 TGCCCCTGCTACTCCTCAACGGG + Intergenic
1196064984 X:111454345-111454367 TGCCCCAGTTCTCCTTCATGTGG + Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1197691224 X:129503101-129503123 TGCCCTCCTTCTCCCTCATCAGG - Intronic
1199399165 X:147376726-147376748 TGCCCCTGCTGTTCCTCACTGGG - Intergenic
1199512515 X:148638356-148638378 TTCCCCTGCTCTCTCCCCTCCGG - Intronic
1199670160 X:150139127-150139149 TGCCCATGCTGTCTGTCATCTGG + Intergenic
1199798636 X:151227804-151227826 GGCCCCGGCTCTCCCTCCTCTGG + Intergenic
1200215813 X:154367823-154367845 TGCCTCTGCGCCCCCTCACCCGG + Exonic
1201609306 Y:15823163-15823185 TGCTCCTGCACTCCCTCACCTGG - Intergenic