ID: 1184566529

View in Genome Browser
Species Human (GRCh38)
Location 22:45295352-45295374
Sequence GTTCACATCATTCCAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184566524_1184566529 3 Left 1184566524 22:45295326-45295348 CCAGCTCCCAATAAGACCTATAA 0: 1
1: 0
2: 1
3: 2
4: 80
Right 1184566529 22:45295352-45295374 GTTCACATCATTCCAAAAGGTGG 0: 1
1: 0
2: 4
3: 14
4: 158
1184566526_1184566529 -4 Left 1184566526 22:45295333-45295355 CCAATAAGACCTATAAGTTGTTC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1184566529 22:45295352-45295374 GTTCACATCATTCCAAAAGGTGG 0: 1
1: 0
2: 4
3: 14
4: 158
1184566523_1184566529 14 Left 1184566523 22:45295315-45295337 CCTCAAATTGTCCAGCTCCCAAT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1184566529 22:45295352-45295374 GTTCACATCATTCCAAAAGGTGG 0: 1
1: 0
2: 4
3: 14
4: 158
1184566525_1184566529 -3 Left 1184566525 22:45295332-45295354 CCCAATAAGACCTATAAGTTGTT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1184566529 22:45295352-45295374 GTTCACATCATTCCAAAAGGTGG 0: 1
1: 0
2: 4
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184566529 Original CRISPR GTTCACATCATTCCAAAAGG TGG Intronic
904362191 1:29983494-29983516 GTTCAGATCAATGTAAAAGGAGG - Intergenic
909953031 1:81742560-81742582 CTTCACATGATGCCAAAAGAAGG - Intronic
910009705 1:82446363-82446385 ATTCTCATCATTCCAAAGTGTGG + Intergenic
910840236 1:91554382-91554404 GTTTACATAATTCAAAAAGAAGG + Intergenic
911676218 1:100661230-100661252 TTTCCCATCATTCCAAGAGATGG + Intergenic
915707299 1:157857265-157857287 GTTCACTTCTTTCCAAAAGTTGG + Intronic
916531727 1:165662999-165663021 ATTCACATCATTCCACAGCGTGG + Exonic
918158401 1:181872934-181872956 GTTGGCCTCATGCCAAAAGGTGG - Intergenic
918619110 1:186582598-186582620 GCTCTCATAATTCCAACAGGAGG + Intergenic
919475332 1:198025834-198025856 ATTCACATCACTTCAAATGGAGG - Intergenic
919974461 1:202601812-202601834 GTTTCCATCATGCCAAGAGGTGG + Intronic
1065677820 10:28197060-28197082 GTTGACCTCAATCCTAAAGGTGG + Intronic
1065866397 10:29918928-29918950 GTTCTCAGCATTCCAAGAAGAGG - Intergenic
1066249939 10:33623496-33623518 GTTGCCATCATTGCAAATGGTGG - Intergenic
1067530211 10:47065570-47065592 CTTCTCAGCAATCCAAAAGGAGG + Intergenic
1069815229 10:71189607-71189629 TTTTACATAATCCCAAAAGGAGG + Intergenic
1070035464 10:72718426-72718448 ATCCACATCATTCCCAAAGGAGG - Intronic
1071910209 10:90223130-90223152 GTTCACAACTTTCCCAAAGTAGG - Intergenic
1072209803 10:93236064-93236086 GTTTCCATAATTCTAAAAGGAGG + Intergenic
1077597566 11:3547082-3547104 CTTCCCATCATTCCAAAACTTGG + Intergenic
1078274631 11:9831505-9831527 GTTTACTTCATTTCCAAAGGTGG + Intronic
1079884993 11:25976442-25976464 GTTCAACTCATTCCTAAAGATGG + Intergenic
1080169221 11:29279054-29279076 GTACAAATCAATCCTAAAGGAGG - Intergenic
1081307766 11:41534514-41534536 TTTCACATTATTCCAAATGATGG - Intergenic
1084348622 11:68576462-68576484 TTTTACATCATTCCCAATGGGGG + Intronic
1086565969 11:88226697-88226719 GTTGAAAGCATTCCAAAAAGTGG - Intergenic
1089887215 11:121839022-121839044 TTGCACAGCATTCCAAAGGGTGG - Intergenic
1090150598 11:124379652-124379674 GTCCAGATCATTCAAAGAGGTGG - Intergenic
1092604031 12:10099761-10099783 TTTCTCAGCATTCCAGAAGGTGG + Intronic
1094625952 12:32124407-32124429 GTTCACATCATTTCAAATATTGG - Intronic
1097806824 12:63974370-63974392 GTTAACATCATTACAAATGAAGG + Intronic
1099592046 12:84605677-84605699 CTTCATTTCATTCCAAAAGAGGG + Intergenic
1100747168 12:97659191-97659213 CTTCACAACATTCCCAAAGTAGG + Intergenic
1101325934 12:103716043-103716065 TTTCACCTCATTCCCAAAGAAGG - Intronic
1101339480 12:103829696-103829718 GTTGAAATCAGTCCAAAAGTGGG - Intronic
1101344846 12:103877609-103877631 GTGAACATCCTTCCAAAAGCAGG - Intergenic
1102962632 12:117102508-117102530 GTGCACATCATTGCCAGAGGAGG - Intergenic
1107502844 13:40998058-40998080 GATCACTTCAGCCCAAAAGGTGG + Intronic
1107503199 13:41002123-41002145 GTACAGATAAATCCAAAAGGAGG + Intronic
1114679022 14:24467945-24467967 GATCAGACCATTTCAAAAGGTGG - Intergenic
1115118993 14:29916948-29916970 GTTCTTATCATTACAAAAAGTGG - Intronic
1115683870 14:35772691-35772713 CTTGCAATCATTCCAAAAGGAGG + Intronic
1117974611 14:61284918-61284940 CTTCATCTCATTCCAAAATGAGG - Intronic
1118019758 14:61698398-61698420 CTTATCATCATTTCAAAAGGAGG - Intronic
1121991599 14:98563040-98563062 GTGCATATTGTTCCAAAAGGTGG - Intergenic
1125117642 15:36113926-36113948 GATAAAATCATTGCAAAAGGAGG - Intergenic
1134674964 16:16083765-16083787 GTCCACAGCTTTCCAAAGGGGGG + Intronic
1139271292 16:65685710-65685732 GTGGACATTATTCCAAAAGGTGG + Intergenic
1139849601 16:69942738-69942760 GCTCACCTCCTTCCTAAAGGAGG + Intergenic
1140229280 16:73104180-73104202 GAGCACATAATTCCAAAACGTGG - Intergenic
1143799927 17:9370350-9370372 GTTCCCTTCACTCTAAAAGGAGG - Intronic
1144200863 17:12941208-12941230 GATCACATCATAGAAAAAGGTGG + Intronic
1146535056 17:33642760-33642782 GTTCACATTATACCAAAATAAGG - Intronic
1148256674 17:46139562-46139584 GTTCATATCACTCCAAAGGCTGG - Intronic
1149583494 17:57768102-57768124 GTTCGGTTCATTCCAAAAAGTGG + Intergenic
1150973047 17:70052274-70052296 TTTCAAATCATACTAAAAGGTGG - Intergenic
1153319768 18:3760994-3761016 ATTCACACAATTCCATAAGGTGG - Intronic
1153380892 18:4438332-4438354 GTTCACACCATTCTGAAATGTGG - Intronic
1160043498 18:75366633-75366655 TTGCAAATCATTCCAAAATGGGG + Intergenic
1164845113 19:31425632-31425654 GATTACATCTTTCCAAAAGAGGG + Intergenic
926501362 2:13657289-13657311 CTTCTCATAATTCCAAAATGTGG - Intergenic
926805054 2:16700689-16700711 TTTCTCATCCTTCCGAAAGGAGG + Intergenic
927917823 2:26947937-26947959 GTTTCCCACATTCCAAAAGGGGG + Exonic
929176512 2:38983119-38983141 GTTAACCACATTCCAAAATGTGG - Exonic
929754999 2:44757046-44757068 TTTCACACCAATCCACAAGGTGG - Intronic
935444596 2:103142656-103142678 TTCCACATCATTCTAAAAAGAGG - Intergenic
935591567 2:104850586-104850608 CTACACTTCATTCCCAAAGGAGG - Intergenic
936616150 2:114049605-114049627 GCTCACATTATTTCACAAGGAGG - Intergenic
939361233 2:141175463-141175485 GTTCACATCATTGCATCAGAGGG + Intronic
939665111 2:144942138-144942160 GTTCACATCATTCTAGAAACAGG + Intergenic
940452590 2:153858507-153858529 GTTCACTGCAGTCCAAAAGTAGG + Intergenic
942382088 2:175402279-175402301 GGCCACATCACTCCAAAATGAGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948635020 2:239329259-239329281 GTTCCTGTCATTCCAATAGGAGG - Intronic
1169574382 20:6941960-6941982 GTTCACATCAGTGCACAATGGGG - Intergenic
1172174757 20:32965606-32965628 CCTCACATCATTCCACGAGGTGG + Intergenic
1173015433 20:39221026-39221048 GTTCACATCCTTCTGAGAGGAGG + Intergenic
1176020917 20:62961993-62962015 GTTAACATCATGGCAAAAGGAGG - Intronic
1184566529 22:45295352-45295374 GTTCACATCATTCCAAAAGGTGG + Intronic
1184825224 22:46946091-46946113 GTACACAGCTTTCCAAAGGGAGG + Intronic
949291475 3:2471670-2471692 GTTCACAGTATTCCAAAATGAGG + Intronic
953762139 3:45697110-45697132 ATTCACAACAGTCAAAAAGGAGG + Intronic
954495546 3:50956568-50956590 GTTCACTACATCCCAGAAGGTGG + Intronic
957183989 3:76918047-76918069 GATCCCCTCGTTCCAAAAGGAGG + Intronic
959279812 3:104323648-104323670 GTTGGCTTCATTCCAGAAGGTGG - Intergenic
961537940 3:127581181-127581203 GTTCAAATCATTCTAAATGTTGG - Intronic
962395792 3:135014361-135014383 CTTCAAAGCTTTCCAAAAGGGGG + Intronic
962655630 3:137541893-137541915 GGCCACAACATTCCAATAGGTGG + Intergenic
964296434 3:155239409-155239431 GGTCACAACACTCCAATAGGTGG + Intergenic
964305555 3:155335820-155335842 GGACAAATCATTCCAATAGGAGG + Intergenic
965670841 3:171146312-171146334 CTTTTCCTCATTCCAAAAGGAGG - Intronic
966910252 3:184555606-184555628 GTTCATCTCCTTCCCAAAGGAGG - Intronic
967176961 3:186869189-186869211 ATTCAAATCATTTGAAAAGGCGG - Intergenic
969375362 4:6760177-6760199 ATTCAGAACATTCCAACAGGAGG + Intergenic
971443776 4:26719604-26719626 GTTCACATGATTTCAGAATGGGG - Intronic
971884927 4:32432232-32432254 GGTCACAACATTCCAAGGGGTGG - Intergenic
973874522 4:55203537-55203559 GATCACATGATTCCAAAAGATGG + Intergenic
974511652 4:62850774-62850796 GTAAAAATCATTCTAAAAGGAGG + Intergenic
979374906 4:119934796-119934818 GTTCACATCAGTCAAAAAGGTGG + Intergenic
979383746 4:120039614-120039636 GTTCACATCAATCAAAAAGGTGG - Intergenic
979908424 4:126328639-126328661 CTTCATATCATTTTAAAAGGGGG + Intergenic
981731722 4:147906253-147906275 GTTCACAACAGGCAAAAAGGTGG + Intronic
983832813 4:172350848-172350870 GTTCTCATAATTCAGAAAGGAGG - Intronic
984697196 4:182791089-182791111 CTTCAGATGATTCCAAAAGTAGG + Intronic
986344213 5:6819364-6819386 GTTGAGATTATTCCACAAGGGGG - Intergenic
986882160 5:12187446-12187468 GTTTACAACATTTAAAAAGGGGG + Intergenic
987111410 5:14690788-14690810 GTACCCCTCATTCAAAAAGGTGG - Intronic
988035812 5:25825623-25825645 AATGCCATCATTCCAAAAGGTGG + Intergenic
988264650 5:28931819-28931841 GTTCACATGTTTGCAAAAGGTGG - Intergenic
988588139 5:32525616-32525638 GTTCACTTCATTCCGAACGATGG - Intergenic
996764416 5:127021313-127021335 GTTCACAACATGCAAAAAGCAGG + Intronic
997413154 5:133705434-133705456 GGTCCCACCATTCCAGAAGGAGG - Intergenic
998862192 5:146455147-146455169 CCTCGCATCATACCAAAAGGTGG - Exonic
1000189326 5:158893997-158894019 GATTACATCATTAAAAAAGGAGG + Intronic
1001670884 5:173472971-173472993 GTTTCTAACATTCCAAAAGGAGG + Intergenic
1002960566 6:1910981-1911003 GTTCACTTCATTTCCCAAGGTGG + Intronic
1004227393 6:13798893-13798915 GATCACTTCATCCTAAAAGGAGG + Exonic
1005290605 6:24375203-24375225 TTTCACCTCATTCCACAGGGAGG - Intergenic
1006199563 6:32275656-32275678 ATAAAAATCATTCCAAAAGGAGG - Intergenic
1008174315 6:48248446-48248468 TTTCACAATTTTCCAAAAGGTGG + Intergenic
1010010407 6:71041813-71041835 GTTCACATCTTTCTCTAAGGTGG - Intergenic
1010225465 6:73484732-73484754 GTTCACATTATTTCAAAAGTTGG + Intronic
1010315552 6:74445204-74445226 GCTCACATAACTCCAAAAGTGGG + Intergenic
1011797431 6:90972184-90972206 GTACACTTCCTTCGAAAAGGAGG + Intergenic
1012230399 6:96754297-96754319 GCTCACATCTTTCCAAAACATGG + Intergenic
1013421044 6:109967388-109967410 TTTCACATCATGCAAAAAGCTGG + Intergenic
1013667685 6:112365591-112365613 TTTCTCATCATTCCAAGAGATGG - Intergenic
1015861434 6:137684674-137684696 GATCACATCACTCCAAGAGATGG - Intergenic
1016845821 6:148567412-148567434 GGTCAGATCATGCTAAAAGGAGG - Intergenic
1017684215 6:156895585-156895607 GTCCACATCCTCCCAAAAAGAGG - Intronic
1018305981 6:162455694-162455716 TTTTACATCATGTCAAAAGGCGG + Intronic
1026141519 7:67710880-67710902 GGTCACGTCATTCTAAGAGGTGG - Intergenic
1027641609 7:80740507-80740529 GTTCACATCAGCTCAAAAGAAGG + Intergenic
1030807098 7:113931975-113931997 GGTCACATTGTTCCAAGAGGTGG + Intronic
1031702793 7:124945552-124945574 GTTCATAGCACTCCAATAGGTGG - Intergenic
1033449709 7:141451451-141451473 GGCCACATCATTCCCAAAGCTGG + Intronic
1033615584 7:143011261-143011283 GTTCACATCCGGCCATAAGGAGG - Intergenic
1033615607 7:143011413-143011435 GTTCACATCCGGCCATAAGGAGG - Intergenic
1033615638 7:143011629-143011651 GTTCACATCCGGCCATAAGGAGG - Intergenic
1035014271 7:155751076-155751098 ATACATATCATTCCAAAAGTGGG - Intronic
1035828085 8:2665752-2665774 CTTCAGGTCATTCCAACAGGTGG - Intergenic
1035843180 8:2834587-2834609 GATCTCATTATTCCATAAGGCGG + Intergenic
1037958775 8:23080328-23080350 GTGAACACCATTCCTAAAGGTGG - Intergenic
1039638558 8:39193899-39193921 GGCCACAACATTCCAATAGGTGG + Intronic
1039795108 8:40906150-40906172 TTTGACAGCATTCCAACAGGAGG - Intergenic
1041396938 8:57401370-57401392 ATTCAGATCATTCCAAATTGAGG + Intergenic
1041683066 8:60612879-60612901 CTCCATCTCATTCCAAAAGGTGG + Intronic
1041735263 8:61104562-61104584 ATTCACATCATTTGAAAAGTTGG + Intronic
1043756391 8:84008997-84009019 GTTCAGCTCCTTCCCAAAGGAGG - Intergenic
1044644766 8:94427839-94427861 GTTGACATTACTCCAAAAGAAGG + Intronic
1047451656 8:124970359-124970381 GTTCACAGCACTCTCAAAGGTGG + Intergenic
1047907069 8:129483462-129483484 GTGCACAGCCTTTCAAAAGGGGG + Intergenic
1048082764 8:131147230-131147252 GTTGACATCAGTCCAAAAGTGGG - Intergenic
1052027486 9:23589695-23589717 ATTCACATGAGACCAAAAGGGGG + Intergenic
1052962504 9:34312178-34312200 TTTCAGATCATTCCAAAAGGTGG + Intronic
1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG + Exonic
1054993271 9:71354839-71354861 TTTCACTTCTTTCCACAAGGTGG + Intronic
1055715120 9:79109010-79109032 GGTCACATCAGTGCAAGAGGTGG - Intergenic
1055931054 9:81560226-81560248 GTTGACTTCATTCAAAATGGTGG + Intergenic
1057705975 9:97395451-97395473 CTTCACAATATTCCAAAAGGAGG - Intergenic
1059793842 9:117669228-117669250 TTTCACATGGTTCCAAAAGACGG - Intergenic
1185780465 X:2839923-2839945 ATTCTCACCACTCCAAAAGGAGG - Intronic
1186566495 X:10668483-10668505 GTTCACATAATTTAAAAAGACGG + Intronic
1188342620 X:29023051-29023073 TTTCACTTCATGCCAAAAGGAGG + Intronic
1188868928 X:35349837-35349859 ATTATAATCATTCCAAAAGGAGG + Intergenic
1192487207 X:71538476-71538498 TTTCACATCATTCCATATAGTGG - Intronic
1193518770 X:82503334-82503356 GGCCACAACATTCCAATAGGTGG + Intergenic
1194882290 X:99268882-99268904 GTTGACATTATTCCACAAGATGG - Intergenic
1196308429 X:114131926-114131948 GTTCTCATCTATCCAAAAGTAGG + Intergenic
1197370523 X:125621149-125621171 GGTCACAACATTCCAATAGGTGG + Intergenic
1197640751 X:128965578-128965600 GTTCAAATCAGTCCAAAAGTTGG - Intergenic
1199071224 X:143477406-143477428 GGTCACATCAATGCAAGAGGTGG - Intergenic
1201289594 Y:12410055-12410077 ATTCTCATCACTCCAAAAGGAGG + Intergenic
1201795133 Y:17888591-17888613 GTTAAGATAAATCCAAAAGGAGG + Intergenic
1201806422 Y:18017390-18017412 GTTAAGATAAATCCAAAAGGAGG - Intergenic
1202356573 Y:24057673-24057695 GTTAAGATAAATCCAAAAGGAGG + Intergenic
1202514205 Y:25612436-25612458 GTTAAGATAAATCCAAAAGGAGG - Intergenic