ID: 1184568775

View in Genome Browser
Species Human (GRCh38)
Location 22:45309600-45309622
Sequence CCTCATTTGCAGAAAGGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 253}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184568775_1184568784 0 Left 1184568775 22:45309600-45309622 CCGCCCCCTTTCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 28
4: 253
Right 1184568784 22:45309623-45309645 AAACGGGACGCGCGGCTCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 27
1184568775_1184568793 30 Left 1184568775 22:45309600-45309622 CCGCCCCCTTTCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 28
4: 253
Right 1184568793 22:45309653-45309675 AGGGCTAGGACGCGGACTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 74
1184568775_1184568788 11 Left 1184568775 22:45309600-45309622 CCGCCCCCTTTCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 28
4: 253
Right 1184568788 22:45309634-45309656 GCGGCTCGCCGGGCCAGGTAGGG 0: 1
1: 0
2: 0
3: 0
4: 56
1184568775_1184568787 10 Left 1184568775 22:45309600-45309622 CCGCCCCCTTTCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 28
4: 253
Right 1184568787 22:45309633-45309655 CGCGGCTCGCCGGGCCAGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 119
1184568775_1184568783 -8 Left 1184568775 22:45309600-45309622 CCGCCCCCTTTCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 28
4: 253
Right 1184568783 22:45309615-45309637 AAATGAGGAAACGGGACGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 89
1184568775_1184568791 22 Left 1184568775 22:45309600-45309622 CCGCCCCCTTTCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 28
4: 253
Right 1184568791 22:45309645-45309667 GGCCAGGTAGGGCTAGGACGCGG 0: 1
1: 0
2: 3
3: 12
4: 207
1184568775_1184568785 1 Left 1184568775 22:45309600-45309622 CCGCCCCCTTTCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 28
4: 253
Right 1184568785 22:45309624-45309646 AACGGGACGCGCGGCTCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1184568775_1184568789 16 Left 1184568775 22:45309600-45309622 CCGCCCCCTTTCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 28
4: 253
Right 1184568789 22:45309639-45309661 TCGCCGGGCCAGGTAGGGCTAGG 0: 1
1: 0
2: 1
3: 7
4: 94
1184568775_1184568786 6 Left 1184568775 22:45309600-45309622 CCGCCCCCTTTCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 28
4: 253
Right 1184568786 22:45309629-45309651 GACGCGCGGCTCGCCGGGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184568775 Original CRISPR CCTCATTTGCAGAAAGGGGG CGG (reversed) Exonic
902771119 1:18646249-18646271 CCTAATTTGAAGAGAGAGGGAGG - Intronic
902986954 1:20160755-20160777 CCTCATTTTGAGAAAGTGGGTGG + Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
904113876 1:28147720-28147742 CCAAATTCGCAGAAAAGGGGAGG + Exonic
904536256 1:31201664-31201686 CCTCATTTATAAAAAGGGGTAGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906248412 1:44293198-44293220 CTTCAATGGCAGAAAGGGGTGGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
910449548 1:87331610-87331632 CCTCATTTGCTGGAGGCGGGCGG + Intronic
911520125 1:98919650-98919672 CCTCAGTGGCACAAAGAGGGAGG - Intronic
911872918 1:103121824-103121846 CCTCTTTTGCAGAAATGGAAAGG + Intergenic
912232153 1:107806651-107806673 CCTCATTTGAAGAAAACTGGTGG - Intronic
912586455 1:110771413-110771435 CCTCATTTCCAGAAACTGGTTGG - Intergenic
916317934 1:163471112-163471134 CCTCTTTTGCAGTTAGGGTGAGG + Intergenic
916770785 1:167905447-167905469 ACTCATTTGCAGGAAGGGGTAGG + Intronic
917470661 1:175323417-175323439 CTTCATTTCCACAAAGGGGATGG + Exonic
919899630 1:202034524-202034546 CCTTATTTGGGGAATGGGGGTGG + Intergenic
923811902 1:237327672-237327694 CATCATTTCCAGAAATGGAGAGG + Intronic
1062769546 10:88025-88047 CCTCATTTCTAGACAGGGAGAGG + Intergenic
1063682177 10:8199284-8199306 CTTCTTTTTCAGAAAGGGCGTGG + Intergenic
1064276142 10:13906861-13906883 CCTCAATTGCTGAAAGGTTGTGG - Intronic
1064670531 10:17709068-17709090 ACTCATTAGCACAAATGGGGCGG - Intronic
1065471441 10:26086023-26086045 ACTCATTTGCAGGTAGGGGGAGG + Intronic
1066657145 10:37706373-37706395 CCTGATTGGCAGAAAGGCTGCGG - Intergenic
1067451467 10:46384597-46384619 CCTCATTTGTACAACGGGGGTGG - Intronic
1067585772 10:47475159-47475181 CCTCATTTGTACAATGGGGGTGG + Intronic
1069262036 10:66410618-66410640 CCTAATATGCAGAAAGGCAGAGG - Intronic
1069610039 10:69766819-69766841 CCTCATCTCCACAAAGGAGGAGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072772178 10:98151359-98151381 CCTCATTTGTAAAATGGAGGTGG + Intronic
1073799116 10:107022084-107022106 CCTCATTTCCAGGATGGAGGAGG + Intronic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075846519 10:125549314-125549336 CATCTTTTGCAGAAAAGGGATGG + Intergenic
1077540077 11:3142518-3142540 CCTCATCTGTAAAAAGGGAGGGG - Intronic
1079307780 11:19338910-19338932 CCTCATCTGCAGAATGGCTGTGG - Intergenic
1080173909 11:29339199-29339221 CCACATTTGTGGAAAGGAGGAGG + Intergenic
1080765070 11:35288393-35288415 CCTCATTTGCATGCAGGGGATGG + Intronic
1082205080 11:49423449-49423471 GCTCATTTATAGAAAGGGGATGG + Intergenic
1083185010 11:61012464-61012486 CCCCATTTGCAGACAGAGAGGGG + Intronic
1085293748 11:75418712-75418734 CCTCATTTTCACAAAGAAGGTGG + Intronic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1088607053 11:111541881-111541903 TCTCATTTGCAGGAAGGCGAAGG - Intronic
1088740903 11:112765992-112766014 CCACAATTGCAGTAAGGGGAGGG - Intergenic
1088904331 11:114142875-114142897 TCTCATTTACAAAAACGGGGAGG + Intronic
1090053362 11:123400607-123400629 CCTCATGTGCAGAAGTGGTGAGG + Intergenic
1090237468 11:125160077-125160099 CATCCTTTGGAGAAAGGGGTGGG - Intergenic
1090459836 11:126881251-126881273 CCCCATTAACAGAGAGGGGGAGG - Intronic
1091390589 12:123850-123872 CCTCATTTATAAAAATGGGGAGG + Intronic
1092380672 12:7994275-7994297 CCTAATTTGCAGAAAGGCACTGG + Intergenic
1093435718 12:19131321-19131343 CCAAATTTGCAAAAAGGTGGAGG + Intronic
1095989741 12:48026489-48026511 CCCCACTTGCAGGGAGGGGGAGG - Intergenic
1096570157 12:52518272-52518294 CCTCATAGGCAGAGAGGGAGGGG + Intronic
1097434850 12:59544073-59544095 TCTAATATGCAGGAAGGGGGTGG + Intergenic
1098859693 12:75694155-75694177 CCTGACTTGCAGAAATGGAGAGG - Intergenic
1101288262 12:103338780-103338802 GTGCATTTGCAGAAAGGGGTGGG + Intronic
1101963818 12:109268568-109268590 CCTCATCTGCACAACAGGGGTGG - Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1112520284 13:100088986-100089008 CCTAACTTGCGGAAAGGGGAGGG - Intergenic
1113503051 13:110793407-110793429 GCTCCTTGGCAGAAAGGGGTGGG + Intergenic
1113524525 13:110964380-110964402 CCCCATTTGCAGATAAGAGGTGG + Intergenic
1114363279 14:21999668-21999690 CCTCCCTTGCAGATAGGAGGAGG - Intergenic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114949174 14:27725815-27725837 CCTTATTTGCAAAGAGGAGGAGG + Intergenic
1115468332 14:33740859-33740881 CCTAATTTTCAGAAAGAGAGAGG - Intronic
1115723977 14:36193249-36193271 TCTCATTTTCTGAAAGGAGGCGG + Intergenic
1116519903 14:45834780-45834802 CCTAATATTCAGAAAGGGAGAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1119749415 14:77066930-77066952 CCTCATTAGCAGGAAGTGGGAGG + Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120943649 14:89973621-89973643 CCACATTTGCAAAATGGGAGAGG - Intronic
1121767984 14:96503458-96503480 TCTCATTATCAGAAAGGGGGAGG - Intronic
1123670744 15:22654404-22654426 CCTCACTTGGTGAAAGGGGCAGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1125488670 15:40129963-40129985 CCTAATTTCCAGCAAGGGAGAGG - Intergenic
1126802754 15:52315257-52315279 CCACACTTGCAGAAACTGGGAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1128300522 15:66563995-66564017 CCTCCTGTGCAGACAGGGGTGGG + Exonic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129109329 15:73328604-73328626 CCTCATCTGCAGGGCGGGGGTGG - Intronic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129542934 15:76365787-76365809 CCTCATTTCCAGAGAGGAGAAGG - Intronic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1131072429 15:89474660-89474682 CCTCAACTGCTGAAAGGGGTGGG + Intronic
1131677273 15:94683318-94683340 CCTCCTCTGTAAAAAGGGGGTGG - Intergenic
1132458680 16:38571-38593 CCTCATTTCTAGAAAGGGAGAGG + Intergenic
1133218791 16:4309341-4309363 CCTCATTTCCTGAAAGGCCGTGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1135762880 16:25151664-25151686 CCCCATCTTCAAAAAGGGGGTGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1139824227 16:69744623-69744645 ACTCATTTGGAGTAAGGCGGAGG - Intronic
1140489070 16:75318939-75318961 TCTCATTTCTAGAAAGGGGCAGG - Intronic
1140509815 16:75498910-75498932 TGTCCTTTGCAGGAAGGGGGAGG + Intergenic
1140515611 16:75539118-75539140 TGTCCTTTGCAGGAAGGGGGAGG + Exonic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141646985 16:85372849-85372871 TCTCATCTGCAACAAGGGGGAGG - Intergenic
1141684108 16:85560631-85560653 CCCCATTTGCAGGAAGGTGGAGG - Intergenic
1141937259 16:87249163-87249185 CTCCATTTGCAGAAAGGGCATGG - Intronic
1142592591 17:1012874-1012896 CCTCATTTGCAGTCTTGGGGAGG - Intronic
1142846596 17:2682183-2682205 CCTCATTTGGGGAAAAGTGGTGG + Exonic
1143726491 17:8850442-8850464 CCCCATCTGCAGAACTGGGGAGG - Intronic
1144138774 17:12324758-12324780 CCTGATTTGCAAAAAGGTGAGGG + Intergenic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145052198 17:19671364-19671386 CCTCATTTCCAGAGAGGGAAAGG - Intronic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147880065 17:43647674-43647696 CCCTATTTGCAGAACTGGGGTGG - Intronic
1148496454 17:48055894-48055916 TTTCATTTGCATAAAGGGGTGGG - Intronic
1148970020 17:51471562-51471584 CCTCAATCTGAGAAAGGGGGTGG + Intergenic
1151138929 17:71973308-71973330 CCTTATTTGCAGAAAGTGTGTGG + Intergenic
1152130333 17:78472455-78472477 TCTCATTTGCAGGAAGCTGGCGG + Intronic
1152790126 17:82274168-82274190 CCTCATTTTGTGAAAGGTGGTGG - Intergenic
1153470327 18:5437278-5437300 CCTCATGTGGTGAAAGGGTGAGG - Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156527254 18:37778594-37778616 CCTCAGGTGCAGAAGGGAGGTGG - Intergenic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1158904069 18:61994286-61994308 CCTCATTTGCTGAAAGCGCTGGG + Intergenic
1160021376 18:75184315-75184337 CCTCATTTACACAAGGAGGGAGG + Intergenic
1160179428 18:76620937-76620959 CAGCATTTGCACAAAGGAGGGGG - Intergenic
1160895315 19:1399642-1399664 CCCCACCTGCAGAAAGGGAGCGG + Intronic
1161062310 19:2221446-2221468 CCTCATTGGCAGAAGCAGGGAGG + Intronic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1164937221 19:32224128-32224150 TCTCATTTCCAGAACAGGGGCGG - Intergenic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1167026822 19:46925778-46925800 CCTCTTTTGCAGAAAGAATGTGG - Intronic
1167350296 19:48969931-48969953 GCTCATCTGCATAAAGGGTGTGG - Intronic
1167783338 19:51615308-51615330 GCTCATTTGAAGAAAAGGGGTGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168650880 19:58091440-58091462 CACCATTTCCAGAAACGGGGAGG - Intronic
926404120 2:12532536-12532558 TCTCATTTGCAAAAAGGGAATGG + Intergenic
926886203 2:17601210-17601232 CCTTATTTGTAAAATGGGGGAGG - Intronic
927018481 2:18993544-18993566 CCTCATTTGGAGAACAGGGTCGG + Intergenic
927150093 2:20190527-20190549 CCTCATTTGCGAAAAGAGGGTGG + Intergenic
927600062 2:24432899-24432921 CCTCATTTGCAAAATGCTGGGGG - Intergenic
927687006 2:25178048-25178070 CCTCATTTGAACAATGGGGGCGG + Intergenic
928008970 2:27590129-27590151 TATCAGTTGCTGAAAGGGGGAGG + Intronic
928154989 2:28868616-28868638 CCTGATCTGGAGAAAGGAGGAGG + Intronic
928167700 2:28982584-28982606 ACAGATTTGAAGAAAGGGGGAGG + Intronic
929432033 2:41895349-41895371 CCTCATTTCCATATAGAGGGTGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
937105850 2:119312010-119312032 CCTCATTGGTAGAAAAGGGGAGG + Intronic
937838918 2:126505391-126505413 CATCATTAGCAGAAAAGGAGCGG + Intergenic
938064428 2:128273401-128273423 TCACATCTGCAGAAAGGGGCAGG - Intronic
940004620 2:148999282-148999304 CTTCATCTACAGAAAGCGGGAGG - Intronic
944562822 2:200958463-200958485 GCACATTAACAGAAAGGGGGTGG + Intronic
945027925 2:205637075-205637097 CCTCATTTGGTAAAGGGGGGTGG - Intergenic
945967251 2:216201707-216201729 TCTCTTCTGCAGAAAGGGGTAGG - Intronic
947947904 2:234122138-234122160 CATTATTTGCAGAAAGGAGTAGG - Intergenic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
1170031371 20:11947703-11947725 CCTCATTTTTAAAAAGGGGGAGG - Intergenic
1170731861 20:18982965-18982987 CATCATTTGCAGGGAGTGGGAGG + Intergenic
1172298332 20:33829998-33830020 CCTCATTTGTAAAATGGGAGTGG - Intronic
1172896035 20:38300636-38300658 CCCCAATTTCAGAAAGGTGGAGG + Intronic
1174307503 20:49624584-49624606 TCTCATTTGGAGAAGGGAGGTGG - Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175374568 20:58515331-58515353 CCTCATTTACAGACAGAGGCCGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1176035223 20:63032966-63032988 CCCCAAGTGCAGAAAGGAGGTGG + Intergenic
1178613719 21:34111327-34111349 CCTCCTTGGCAGGAAGCGGGTGG - Intronic
1179170039 21:38965912-38965934 CCTCATTTGCAGAAACAGGTGGG - Intergenic
1180008321 21:45033434-45033456 CCTCGCTTGCAGAGAGGGGCCGG + Intergenic
1181099689 22:20531053-20531075 CTTCCTTTGCACAAAGGGTGGGG - Intronic
1182035707 22:27196703-27196725 CCTCAGTTGCAGAGAGGGTGGGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183396556 22:37574779-37574801 CCTCCTCTGCAGAGAGGAGGCGG - Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184669825 22:46006795-46006817 CCCCATCTGCAGACAGGAGGCGG - Intergenic
1184686515 22:46098811-46098833 CCTCAGTTGCAGAAAGAAAGAGG - Intronic
1184749910 22:46479351-46479373 CCTCCTGTGCAGAAAGGCTGCGG + Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1184909317 22:47515959-47515981 CCTCAATGGCAGAAATGGGTAGG - Intergenic
1184956373 22:47889467-47889489 CCTCATGTGGTGGAAGGGGGAGG + Intergenic
949435028 3:4019862-4019884 CCTCATTTGCTGAAAGGGAAAGG + Intronic
949502530 3:4694966-4694988 CTGCATTTACAAAAAGGGGGTGG - Intronic
952140765 3:30476477-30476499 CCTCATTTGCAGATAAGGAATGG - Intergenic
953021959 3:39120294-39120316 CCTTATTTGGGGAAAGCGGGTGG + Intronic
953038166 3:39231398-39231420 CCTCCTTGGCTGAAAGGGGTAGG + Intergenic
953453842 3:43026102-43026124 CCTCTTTTGCAGACAAGCGGGGG - Intronic
953882972 3:46701149-46701171 GCCCATTTGCAGAAGGGAGGGGG + Intergenic
953993668 3:47503142-47503164 CCTCATTTGAAGGCAGGGGCTGG - Intronic
954786093 3:53093583-53093605 CCTCATGTGCAGAATCTGGGTGG - Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
956810655 3:72861219-72861241 CCTCATTTACACAATGGTGGTGG - Intronic
957459746 3:80501233-80501255 CCTCATGTGATGAAAGGGGCAGG + Intergenic
962756383 3:138468215-138468237 GCTCCCTTGCAGAAAGGTGGAGG + Intronic
963228569 3:142888209-142888231 AGTGATTTTCAGAAAGGGGGAGG - Intronic
963336322 3:143977816-143977838 CCTCAAGTCCAAAAAGGGGGTGG + Intronic
964726102 3:159815870-159815892 TAGCATTTGCAGAACGGGGGTGG - Intronic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965765749 3:172128391-172128413 CCTGATTTGGAGAAAAGAGGGGG + Intronic
966622863 3:181984566-181984588 GCTCCTTTGCAAAAAGGGGGTGG + Intergenic
968671010 4:1851671-1851693 CTTCATGTGGAGAAAGGTGGGGG - Intronic
968972126 4:3801496-3801518 CCTCATCTGCTTAAAGGAGGAGG - Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969472737 4:7399248-7399270 CCTCAAATGCAGACAGAGGGTGG - Intronic
969498584 4:7540018-7540040 CCTCCACAGCAGAAAGGGGGCGG - Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
974235793 4:59179721-59179743 GCTCCTGTGCAGAAAGGGGTGGG + Intergenic
975743373 4:77452342-77452364 GCTCCTCTGCAGAGAGGGGGAGG + Intergenic
976410218 4:84704855-84704877 TCTCCTTGGCAGAGAGGGGGTGG + Intronic
979603876 4:122616395-122616417 CCTCCTTTGGAGAAAGGAAGTGG + Intronic
982358117 4:154491130-154491152 CCTCATCTACGGAAAGGGTGAGG + Intronic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
986082092 5:4405547-4405569 CCTCATTGGCAGAGTGGGTGGGG + Intergenic
991127206 5:63082889-63082911 GCTCCTCTGCAGAGAGGGGGAGG - Intergenic
992283026 5:75201746-75201768 CCTCAATTCCAGAAGGGAGGAGG - Intronic
997684608 5:135779846-135779868 CCTAATATCCAGGAAGGGGGAGG + Intergenic
998725809 5:145012954-145012976 CGTCATTTGCAAAAACGTGGAGG + Intergenic
998778462 5:145629686-145629708 CCTCATTTATAAAAAGGGGCAGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1002449844 5:179312416-179312438 CCTCACATGCTGAAAGGGTGAGG - Intronic
1003422294 6:5969342-5969364 CCTCATTTACAGAAAAGGAGAGG - Intergenic
1006042938 6:31270438-31270460 CCTCATGGTCAGAGAGGGGGTGG + Exonic
1006089568 6:31620614-31620636 CTTAATTTGCATAAAGGGCGGGG - Intergenic
1006449665 6:34098854-34098876 CCTTAGCTGCAGAGAGGGGGTGG + Intronic
1008060717 6:46993854-46993876 CACCATTTACAGAAAGGGAGAGG - Intergenic
1009227031 6:61029480-61029502 CCTAATATCCAGAAAGGGAGAGG - Intergenic
1010131390 6:72498000-72498022 CATCATATGCAGGAAGGGTGAGG - Intergenic
1012711585 6:102613709-102613731 CCTGTGATGCAGAAAGGGGGAGG - Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1012775652 6:103490875-103490897 CCTCATATGCAAAAGGGGAGAGG + Intergenic
1012972500 6:105746420-105746442 CCAGACCTGCAGAAAGGGGGTGG - Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1016921932 6:149304174-149304196 CCTCATTGGGAGAAAGTTGGTGG - Intronic
1019513130 7:1428280-1428302 CCTCATCTGCACACAGGCGGTGG - Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019730923 7:2629149-2629171 CCTTCTTTGAAGAAAGGGGCCGG - Intergenic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1021931522 7:25585810-25585832 TCTGAATTGCAGAAAAGGGGTGG - Intergenic
1024578517 7:50783113-50783135 CCGCATTCGCAGACAGGCGGGGG + Intronic
1026157884 7:67843153-67843175 CCTCCTTCTCAGACAGGGGGAGG + Intergenic
1028914479 7:96243384-96243406 CCACATTTGCAGATGGGTGGAGG + Intronic
1029413280 7:100428694-100428716 CCTCATTGGCAGAAGCTGGGGGG + Intronic
1029424028 7:100485649-100485671 CCAAATTTGCAGAAAGGAGAAGG - Intronic
1030362134 7:108606358-108606380 CTTCATCTGCTGAAAGTGGGGGG - Intergenic
1030889513 7:114982176-114982198 CCTGATGTGCAGAATGGGGCAGG + Intronic
1031979575 7:128116018-128116040 CTGCATTTGCAGAGAGGGGCAGG - Intergenic
1033756662 7:144402217-144402239 CCTGCTTTGCAGGGAGGGGGAGG - Intronic
1034887246 7:154807154-154807176 GCACATTTGCAGGGAGGGGGTGG + Intronic
1036082303 8:5570627-5570649 CTACATTTGCAGCAAGGGAGTGG + Intergenic
1043635002 8:82374667-82374689 CATAATATCCAGAAAGGGGGAGG + Intergenic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044703398 8:94985047-94985069 CCTCCTTTGCAGCTAGGGGATGG + Intronic
1046668042 8:117026695-117026717 CCTTATCTGCAGAACAGGGGAGG + Intronic
1046999756 8:120562267-120562289 CCTCATCTGAACAAAGGGGGCGG - Intronic
1047780293 8:128105582-128105604 GCACATTTGGGGAAAGGGGGAGG - Intergenic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1050346742 9:4696086-4696108 CCTCACTTAAAAAAAGGGGGTGG - Intronic
1050854698 9:10338269-10338291 ACTCATTAGCAGAAAAGGTGAGG - Intronic
1052885947 9:33648060-33648082 CCGCCTTTGCAGAAAGGCAGAGG + Intergenic
1056378148 9:86034360-86034382 CCTCATTTGAAGAAACGCGGTGG - Intronic
1056803968 9:89713619-89713641 CCTGACTTGCAGAAACTGGGTGG - Intergenic
1057565630 9:96164004-96164026 CCTCACTTGAAGAAAGGGCATGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1061092342 9:128433775-128433797 CCTCAATCGCAGGAAGGAGGTGG - Intronic
1061680284 9:132239660-132239682 GCTCCTTTCCAGAAAGGTGGAGG + Intronic
1061727032 9:132587660-132587682 CCACTTTTACAGAATGGGGGAGG - Intronic
1062083437 9:134636520-134636542 CCTCACTCACAGAAAGGGGAGGG + Intergenic
1186446011 X:9629465-9629487 TCTCAGTTTCAGAAAGGGGGAGG + Intronic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1193329836 X:80223644-80223666 CCTAATTGGGAGAAAGTGGGAGG - Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1196303199 X:114069712-114069734 TCTCATTTGCTTAAAGGGAGAGG + Intergenic
1196558155 X:117115972-117115994 CCTCTTTTGGAGACAGGGGATGG - Intergenic
1196872943 X:120130008-120130030 CCTAAATTCCAGAAAGGGTGGGG + Intergenic
1198804194 X:140477099-140477121 CTTCATTTTAAAAAAGGGGGAGG - Intergenic
1199672513 X:150158995-150159017 TTTCATGTGCAGAAAGAGGGAGG - Intergenic
1201385138 Y:13432302-13432324 CTTCATTTTCAGAAATGGGAGGG - Intronic