ID: 1184568888

View in Genome Browser
Species Human (GRCh38)
Location 22:45309939-45309961
Sequence GGCGCCGCTGCCGGCTAACG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184568888 Original CRISPR GGCGCCGCTGCCGGCTAACG CGG Intronic
900109726 1:1000367-1000389 GGGGCCGCTGGGGGCGAACGGGG + Intergenic
900137891 1:1126150-1126172 GCCGCTGCTGCCAGCTGACGGGG - Intergenic
904618987 1:31764270-31764292 GCCGCCGCTGCCGCCGAACCCGG + Intronic
905173977 1:36125075-36125097 GGCGCCGCTCCCGGCCCTCGAGG + Exonic
907069333 1:51519412-51519434 GGCGCCGCGGCCGGCTCCGGCGG - Intergenic
907905703 1:58782653-58782675 GGCGGCGCAGCCGGTCAACGGGG - Exonic
921596487 1:217059596-217059618 GTTGCCCCTGCTGGCTAACGTGG + Intronic
1069698372 10:70404406-70404428 GTGGCCGCTGCCGGCTGACGAGG - Exonic
1075780596 10:125014847-125014869 GGCGTCCCTGCCGGCCAAGGCGG - Intronic
1076668242 10:132104865-132104887 GGCGCTGCAGGCGGCCAACGAGG + Exonic
1077877458 11:6320221-6320243 GGCGCAGCTGCTGGCCAAGGCGG - Exonic
1089543663 11:119206280-119206302 GCCGCCGCCGCCGGCTATCCGGG - Exonic
1094460807 12:30695502-30695524 GGCGCCCCTGCCGGCTGGCCGGG - Intronic
1097019181 12:56007779-56007801 GGCCCCGCCCCCGGCTACCGAGG - Intronic
1097123152 12:56751898-56751920 GGCACCGCTGCAGGTAAACGGGG + Intronic
1103075883 12:117982243-117982265 AGCACCGCTGCTGGCTAACATGG - Intergenic
1104393890 12:128415191-128415213 GGGGCAGCTGCCGGCTGAAGGGG + Exonic
1106556245 13:30810788-30810810 GACGCCGCAGCCGGGTAACACGG + Intergenic
1114062028 14:19026801-19026823 GGCGCCGCTGCCTGGTAAGCGGG - Intergenic
1114100232 14:19373196-19373218 GGCGCCGCTGCCTGGTAAGCGGG + Intergenic
1123494795 15:20814670-20814692 GGCGCCGCTGCCTGGTAAGCGGG + Intergenic
1123551290 15:21383763-21383785 GGCGCCGCTGCCTGGTAAGCGGG + Intergenic
1126053468 15:44708090-44708112 GTGGCCGCTGCCGGCGAATGGGG + Intronic
1127834086 15:62775991-62776013 GGCTCCACTGCTGGCTAACTAGG - Intronic
1130029129 15:80295846-80295868 GTTGCCGCTGCCGGCTCGCGTGG + Intergenic
1202959631 15_KI270727v1_random:111006-111028 GGCGCCGCTGCCTGGTAAGCGGG + Intergenic
1139853745 16:69965352-69965374 GGCGCGGCTGCTGGCTGACCCGG - Intergenic
1139882723 16:70188265-70188287 GGCGCGGCTGCTGGCTGACCCGG - Intergenic
1140369787 16:74407254-74407276 GGCGCGGCTGCTGGCTGACCCGG + Intergenic
1151155504 17:72121242-72121264 GGCGCGTCGGCCGGCTACCGCGG - Exonic
1153489141 18:5630053-5630075 GGCGCCGCGCCCGGCTTCCGCGG + Intronic
1154452197 18:14487191-14487213 GGCGCCGCTGCCTGGTAAGCGGG + Intergenic
1160453495 18:78980322-78980344 GGAGCTGCTGCCGCCTGACGGGG + Exonic
1160900398 19:1424955-1424977 GGCGCGGCCCCCGGCTAACGGGG - Intronic
1161290570 19:3491614-3491636 GGCCGCGCTGCAGGCTCACGCGG - Exonic
1162486021 19:10961051-10961073 GCCGCCGCCGCCGCCAAACGAGG - Exonic
1163679310 19:18671509-18671531 GGCGCCCCTGCCAGCTCACTGGG - Exonic
1165745981 19:38229622-38229644 GGCGCCGCTGCCGCCGCGCGCGG + Intronic
1166853236 19:45770292-45770314 GGGTCCGCGGCCGGCGAACGGGG - Exonic
1167149777 19:47701974-47701996 GGCGCCGCTGCCCGCCAAAGTGG + Exonic
936095975 2:109530347-109530369 GGCGCCACAGCCTGCTCACGTGG - Intergenic
938479393 2:131646982-131647004 GGCGCCGCTGCCTGGTAAGCGGG - Intergenic
948206943 2:236167527-236167549 GGAGGCGCTGCAGGCTGACGCGG - Exonic
1174643174 20:52062823-52062845 GAGGCAGCTGCAGGCTAACGAGG + Intronic
1176443829 21:6801109-6801131 GGCGCCGCTGCCTGGTAAGCGGG - Intergenic
1176821998 21:13666148-13666170 GGCGCCGCTGCCTGGTAAGCGGG - Intergenic
1180297994 22:10961774-10961796 CGCGCCGCCGCAGGCCAACGAGG - Intergenic
1180480516 22:15749415-15749437 GGCGCCGCTGCCTGGTAAGCGGG - Intergenic
1184568888 22:45309939-45309961 GGCGCCGCTGCCGGCTAACGCGG + Intronic
954363853 3:50136098-50136120 GTCCCCGCTGCTGGCTGACGGGG + Intergenic
956417858 3:69052091-69052113 GCCGCCACTGCCGGCTGAGGAGG - Exonic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
968583774 4:1406598-1406620 GGCGCCGCGGGCGCCTAAGGCGG - Intergenic
983656537 4:170090175-170090197 GGCGCCTAGGCCGGCCAACGCGG - Intronic
988228882 5:28449051-28449073 GTCTCCGCTGCTGGCTAACTGGG - Intergenic
988949151 5:36241028-36241050 GGCGCCGCTGAGGGCTGCCGGGG - Intronic
998330298 5:141320327-141320349 GGTGCCGCTGCCGGACAACGCGG + Exonic
998337627 5:141387628-141387650 GGCGCCGCTGTTGGCCAAAGTGG + Intronic
1002190101 5:177473467-177473489 GGAGCTGCTGGCGGCTTACGAGG - Intronic
1006300960 6:33193310-33193332 GGCGCCGCCGCCCGCTGGCGCGG + Intergenic
1031447559 7:121873169-121873191 GCCGCCGCAGCCGGCGAAAGAGG + Exonic
1041648964 8:60282106-60282128 GGCGCTGCTGCAGGCTCACCTGG + Intergenic
1044648997 8:94474908-94474930 GGCGCCGGAGCAGGCCAACGAGG - Intronic
1046336393 8:112794335-112794357 CGCGCCGCTGCCCTCTAACCTGG - Intronic
1203525371 Un_GL000213v1:83418-83440 GGCGCCGCTGCCTGGTAAGCGGG + Intergenic
1200799358 Y:7371756-7371778 GTCGCCGTTGCCAGCTATCGTGG - Intergenic