ID: 1184569679

View in Genome Browser
Species Human (GRCh38)
Location 22:45314243-45314265
Sequence AATGATAAGCACACTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 175}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184569669_1184569679 7 Left 1184569669 22:45314213-45314235 CCCCGCCCCCCAAGCTAACATGG 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569668_1184569679 10 Left 1184569668 22:45314210-45314232 CCACCCCGCCCCCCAAGCTAACA 0: 1
1: 0
2: 3
3: 30
4: 332
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569674_1184569679 1 Left 1184569674 22:45314219-45314241 CCCCCAAGCTAACATGGACAGTT No data
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569675_1184569679 0 Left 1184569675 22:45314220-45314242 CCCCAAGCTAACATGGACAGTTG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569665_1184569679 25 Left 1184569665 22:45314195-45314217 CCTCCTTATCTGTTCCCACCCCG 0: 1
1: 0
2: 2
3: 11
4: 179
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569677_1184569679 -2 Left 1184569677 22:45314222-45314244 CCAAGCTAACATGGACAGTTGAA 0: 1
1: 0
2: 2
3: 4
4: 140
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569673_1184569679 2 Left 1184569673 22:45314218-45314240 CCCCCCAAGCTAACATGGACAGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569667_1184569679 11 Left 1184569667 22:45314209-45314231 CCCACCCCGCCCCCCAAGCTAAC 0: 1
1: 0
2: 3
3: 23
4: 322
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569664_1184569679 26 Left 1184569664 22:45314194-45314216 CCCTCCTTATCTGTTCCCACCCC 0: 1
1: 0
2: 2
3: 46
4: 462
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569672_1184569679 5 Left 1184569672 22:45314215-45314237 CCGCCCCCCAAGCTAACATGGAC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569671_1184569679 6 Left 1184569671 22:45314214-45314236 CCCGCCCCCCAAGCTAACATGGA 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569666_1184569679 22 Left 1184569666 22:45314198-45314220 CCTTATCTGTTCCCACCCCGCCC 0: 1
1: 0
2: 2
3: 26
4: 249
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1184569676_1184569679 -1 Left 1184569676 22:45314221-45314243 CCCAAGCTAACATGGACAGTTGA 0: 1
1: 0
2: 1
3: 29
4: 350
Right 1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184569679 Original CRISPR AATGATAAGCACACTGTGCA GGG Intronic
903666917 1:25013692-25013714 AATGGGAAGGAAACTGTGCAAGG - Intergenic
904438214 1:30513042-30513064 AAGGCAAAGCACTCTGTGCACGG + Intergenic
907450101 1:54540923-54540945 AATGATGAACACCCCGTGCATGG - Intergenic
911508042 1:98778373-98778395 AAAGGGAGGCACACTGTGCAGGG + Intergenic
912030834 1:105241502-105241524 AATGGTAAGCACATTTTTCATGG + Intergenic
915791816 1:158680535-158680557 AAGGATAAGAACCCTTTGCACGG + Intronic
922207084 1:223457220-223457242 AAAGTTAAGCAAATTGTGCAAGG + Intergenic
922982881 1:229842987-229843009 AATCATAAGGACACTGTGGGAGG - Intergenic
1064279066 10:13934528-13934550 AAAGAGAAGCAAACTTTGCAGGG + Intronic
1065293441 10:24253455-24253477 AATGACAAGAACACTCGGCATGG - Intronic
1067409071 10:46048927-46048949 AATGATAATCAGCCTGGGCATGG - Intergenic
1068341824 10:55714169-55714191 AATTATAAGCACATTCTCCAAGG + Intergenic
1069682634 10:70296184-70296206 AATGAGAAACACACTGGGCCAGG + Intergenic
1069999703 10:72367138-72367160 AATGCTAACCAAACTGTGCGGGG + Intergenic
1070615783 10:77968288-77968310 AATGCTTAGCACACAGTGCCTGG - Intergenic
1075616203 10:123892180-123892202 AATGGTCAGCACACGGGGCACGG - Intronic
1081440022 11:43070239-43070261 AATAATAAGCAAAATGTGCCAGG + Intergenic
1083317065 11:61822262-61822284 AATGATAAGAAGACTGGGCCGGG - Intronic
1085413995 11:76308276-76308298 AATCATAACAACACTGTGCTGGG - Intergenic
1087715195 11:101600596-101600618 AATGATGATCACAGTGTGCAAGG + Intronic
1088159608 11:106854189-106854211 AGTGCTATGCACACTGTCCAGGG - Intronic
1088318098 11:108527759-108527781 AATGATAACCACACTCAGAAAGG + Intronic
1089272835 11:117314115-117314137 CATGCTGTGCACACTGTGCATGG - Intronic
1090080305 11:123608012-123608034 AATGAGAGGCACACAGAGCAAGG - Intronic
1090529945 11:127580032-127580054 GATGATAAGCTCACTGTTCTTGG - Intergenic
1090740248 11:129653361-129653383 AATAATAAGCACAAGGTTCACGG + Intergenic
1092744247 12:11658629-11658651 AGTGACAAGAGCACTGTGCAGGG - Intronic
1093516156 12:19989345-19989367 AATGAGAAATACACTGTTCAGGG - Intergenic
1093565783 12:20601558-20601580 AATGTTAATCAAATTGTGCATGG + Intronic
1093636758 12:21480105-21480127 AATGATAAGCCCAGTATGCTGGG + Intronic
1102106278 12:110326574-110326596 AAGGATAATCACACTTTTCATGG + Intronic
1104106133 12:125661359-125661381 ACTGATAAGCACACTGGCCCAGG + Exonic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106401781 13:29438158-29438180 AATGCTACACCCACTGTGCAGGG - Intronic
1106454208 13:29912262-29912284 CATGACAAGGACACTGTGCTGGG + Intergenic
1108182775 13:47857329-47857351 AGTCATAAGCACTGTGTGCAAGG + Intergenic
1109608046 13:64724073-64724095 AATGATTATCAAACTGTGTAGGG - Intergenic
1109880616 13:68470001-68470023 AATGCTTAGCCCACTTTGCATGG - Intergenic
1110319626 13:74147042-74147064 AATGAGAAGAACAATGTGCTGGG - Intergenic
1110539161 13:76688466-76688488 AATAATAGGCACATGGTGCATGG + Intergenic
1111841141 13:93453048-93453070 AATGATAAGCTCTATTTGCATGG + Intronic
1116143079 14:41025623-41025645 AATGATGAGCAGGCTGAGCATGG - Intergenic
1117972234 14:61263209-61263231 AATGATAAACACAAGGTCCAGGG - Intronic
1118519305 14:66563814-66563836 AATGATAAGCATCCAGTGAATGG - Intronic
1120936215 14:89898113-89898135 AATGGAAAACACACTGTGCCAGG + Intronic
1124904776 15:33858156-33858178 AATGATGACGCCACTGTGCAGGG - Intronic
1127743251 15:61935734-61935756 AATGACTAGAACAGTGTGCAAGG - Intronic
1130384797 15:83401720-83401742 AGTGAAGAGCACACTGGGCATGG + Intergenic
1131277770 15:90996204-90996226 AATGTTAATCACAGAGTGCAAGG - Intergenic
1132645279 16:996671-996693 GATGAGAAACTCACTGTGCAGGG - Intergenic
1133921880 16:10160851-10160873 AATGATAAGGAAACTTTGCTTGG + Intronic
1139485087 16:67251251-67251273 AATGAAAAGCACATTGGGCTAGG + Intronic
1140036323 16:71374009-71374031 AATGATGAGCCCACCTTGCACGG - Intronic
1140906730 16:79415558-79415580 AATGCTGACCACACTGAGCAAGG - Intergenic
1146815128 17:35936421-35936443 AATTGTCAGCACACTGTCCATGG - Intronic
1148247355 17:46042339-46042361 GATGATAAACACACAGTGCCTGG - Intronic
1149552472 17:57550461-57550483 AATGAAAAGCACAGTGTGTGAGG - Intronic
1150924860 17:69522209-69522231 AATAATAGGCACACTGTGGAAGG - Intronic
1153421285 18:4908343-4908365 AATGAGACCCACACTGTACATGG + Intergenic
1154954264 18:21240274-21240296 AAAGATAAGGACACTGAACAAGG - Intergenic
1156848506 18:41698303-41698325 ATTTATCAACACACTGTGCAAGG + Intergenic
1158121885 18:54057579-54057601 AATGAAAAGCACGATGTGTAAGG + Intergenic
1159313668 18:66742370-66742392 AATGATAAACTAATTGTGCAAGG + Intergenic
1160071981 18:75636977-75636999 AGTGAGCAGCACACAGTGCACGG + Intergenic
1164615004 19:29662498-29662520 AATGTTTAGCACACAGTGCTTGG + Intergenic
1166998072 19:46729281-46729303 AATGATAATGACAGTGTTCACGG - Intronic
1167742270 19:51330745-51330767 AAGGATAGGAACACTGTGAAGGG + Intergenic
925888815 2:8416687-8416709 AATGATGACCACACTCAGCAGGG - Intergenic
926891286 2:17641095-17641117 AATGATGAGAACACTGAGCCTGG - Intronic
929679993 2:43983992-43984014 AATGATCAGCACATTGTAGATGG + Intronic
930291657 2:49501412-49501434 AAGCCTAAGCACACTGTGCCAGG + Intergenic
930379431 2:50609031-50609053 AATGGAAAGCACACTGGGCTTGG + Intronic
932931772 2:76049636-76049658 AATAATAAGCAAACTCTCCAAGG - Intergenic
933273685 2:80261030-80261052 AATGATAGTCAGACTCTGCACGG + Intronic
933565256 2:83942731-83942753 CATCATAAGCAAACTGTACATGG + Intergenic
934099373 2:88637978-88638000 AATTATAAGCAAAAAGTGCAGGG + Intergenic
937364967 2:121254892-121254914 ACAGATAAGCACCCTGTGAATGG - Intronic
941471784 2:165897117-165897139 AATGAAAAGTACACTGTGTAGGG - Intronic
1170878305 20:20271740-20271762 AATGATAAGAACACTCTGGGTGG - Intronic
1172196900 20:33098018-33098040 AATGCCAAGCAAATTGTGCAAGG - Intronic
1177314739 21:19443400-19443422 AAGGATAAAAACACTGTGTATGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177860657 21:26449437-26449459 AATGATAGGCAGACGGTGCTTGG + Intergenic
1179095340 21:38309627-38309649 AAGGAGAAGCACACTGTTCTGGG - Intergenic
1184428499 22:44427251-44427273 AATGATGAGAACATTGAGCATGG - Intergenic
1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG + Intronic
949359149 3:3213507-3213529 AATGATAAGCAAAATTTGGACGG + Intergenic
949465639 3:4340315-4340337 AGTGGTAAGCACAATGTGAATGG - Intronic
951027406 3:17844588-17844610 ACAGATAAGCACAGTGTACAGGG + Intronic
953230525 3:41061134-41061156 AATAATATGAACACAGTGCACGG - Intergenic
953435170 3:42872087-42872109 ACTGATAAGCACGCTGGGAAGGG + Intronic
956364135 3:68481571-68481593 AATGTTAAGCAAGCTGTTCAAGG - Intronic
960334478 3:116399634-116399656 AGTGATAAAAATACTGTGCATGG + Intronic
961550892 3:127670111-127670133 ACTGAGCACCACACTGTGCAAGG + Intronic
962789460 3:138798024-138798046 AGTGAAAAACACACTGTGCAAGG + Intronic
963223173 3:142833047-142833069 AATGATAAGCACAAAATTCAGGG - Intronic
964054666 3:152438833-152438855 GTTGGTAAGAACACTGTGCATGG + Intronic
965842011 3:172917010-172917032 AAAGAAAAGGAGACTGTGCAAGG - Intronic
967111587 3:186298399-186298421 AATGAGAGGCACAGGGTGCAGGG + Intronic
970268551 4:14317592-14317614 AATTTTAAAAACACTGTGCATGG - Intergenic
970820801 4:20210271-20210293 AATGATGAACAAACTGGGCAAGG + Intergenic
972240602 4:37187842-37187864 AATGTTAAGCACACAGTCCATGG + Intergenic
972399146 4:38684428-38684450 AAGTAAATGCACACTGTGCAGGG + Intronic
978996860 4:115167851-115167873 AATGACAAGCCCACTGTTAATGG + Intergenic
979242621 4:118461684-118461706 AATCATGAGCTCACTGTCCAAGG + Intergenic
980191048 4:129525563-129525585 AAGGATTAACAAACTGTGCATGG + Intergenic
980459501 4:133089156-133089178 AATGCTAAACACACTTAGCATGG - Intergenic
982301014 4:153879570-153879592 ATCCATAAGCACACTGAGCAAGG - Intergenic
984891818 4:184500947-184500969 TATGCTAAGCACAGTGAGCAGGG - Intergenic
988828713 5:34967327-34967349 AATGCCATGCACACTGTCCAGGG - Intergenic
990155172 5:52868752-52868774 AATGTAAACGACACTGTGCAGGG - Intronic
990864679 5:60367694-60367716 AATGACAAGCATACTGAGCCAGG - Intronic
991132942 5:63146297-63146319 ACTGATAAGCAAAATTTGCAAGG + Intergenic
993268054 5:85753325-85753347 AAAGATAATCACACAGTGCTTGG + Intergenic
994189861 5:96857573-96857595 AAAGATAAGGAAACTGAGCATGG + Intronic
994603207 5:101934389-101934411 AATGATCATCAAACTGTGCTCGG + Intergenic
995301663 5:110591635-110591657 TATGATAAGAATACTGTCCATGG - Intronic
995547082 5:113243656-113243678 AAGGATAAACACACTAGGCATGG - Intronic
995740657 5:115352744-115352766 AATGAAAAGCAGGCTGAGCATGG - Intergenic
997215389 5:132105555-132105577 AATCATTAGCACCCTGTGCTGGG - Intergenic
998515888 5:142753710-142753732 AATGTTGAGCACAGTGTGGAAGG + Intergenic
998612129 5:143700725-143700747 AATGATGGGTACACTGTGGAGGG + Intergenic
998666136 5:144299635-144299657 AATAATAAGGCCACTGTCCAAGG - Intronic
999237202 5:150106055-150106077 AATGACCAGCACACTGCACAGGG + Intronic
1001935274 5:175699208-175699230 AATGAAAAGAACACTGTGATTGG + Intergenic
1005409273 6:25525630-25525652 AATGATAACCACAATGTACTGGG + Intronic
1006571723 6:35010949-35010971 AATGAAAAGCTCACTGAGCCTGG + Intronic
1006998785 6:38288639-38288661 AATGTTAAGCCCAGTGGGCATGG + Intronic
1008474065 6:51917479-51917501 AATCAGAAGTGCACTGTGCAAGG + Intronic
1011120973 6:83952249-83952271 AATGTCAAGCACATTTTGCAGGG - Intronic
1011910398 6:92429045-92429067 CATGAAAATCACACTCTGCAAGG - Intergenic
1012790750 6:103692221-103692243 AATGTTAACCACACTTTTCATGG + Intergenic
1013553978 6:111237440-111237462 AAAGATAAATAAACTGTGCATGG - Intergenic
1014276374 6:119394613-119394635 AATGATAGGGACAGAGTGCAGGG - Intergenic
1014287224 6:119514157-119514179 AAAGAAAAGCACACTCTGCCTGG + Intergenic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1016250919 6:142041329-142041351 AAGAACAAGCACAATGTGCAAGG + Intergenic
1017205524 6:151800812-151800834 AATGACAATCACACTGTGGAGGG - Intronic
1019173106 6:170145963-170145985 GGTGATAAGCACACTGCGGAGGG + Intergenic
1019874932 7:3801632-3801654 ATTGATAAGGACCCTGAGCAAGG + Intronic
1020739845 7:12000869-12000891 AATGTTTAGTACACTGTACATGG + Intergenic
1027820822 7:83042568-83042590 AATGATAAGGGGACTGGGCACGG + Intronic
1027971951 7:85094866-85094888 AAGTATAAGCACACATTGCAAGG - Intronic
1028385640 7:90250001-90250023 AATTTTAAGCACACAGTTCATGG - Intronic
1028756164 7:94436678-94436700 GATGATAATAACACTATGCACGG + Intergenic
1029702377 7:102255690-102255712 AATCAGAAGCACAGTGTGTACGG + Exonic
1030901212 7:115126486-115126508 TGTGACAAGCACACTGTGCCAGG - Intergenic
1031331880 7:120475331-120475353 GATGAAAAGTACAATGTGCATGG - Intronic
1031967850 7:128040878-128040900 AACAATTAGCAAACTGTGCAAGG - Intronic
1032456794 7:132079334-132079356 AATGACAAACACACAGTGCAGGG - Intergenic
1033419497 7:141193581-141193603 AAGGGCAAGCACAGTGTGCAGGG + Intronic
1033531536 7:142269080-142269102 TATGAGTAGCACTCTGTGCAGGG + Intergenic
1034898109 7:154890514-154890536 AGTGTTAAGCACACTGACCATGG + Intronic
1035496336 7:159330237-159330259 AGTGAAAAGAACACTGTGTAAGG - Intergenic
1035873518 8:3161779-3161801 AATGATGAGAACAGTTTGCAGGG + Intronic
1036530709 8:9583837-9583859 AATTATAAGCATACTTTTCATGG + Intronic
1038418007 8:27411720-27411742 AAGGATTGGCACACTTTGCAAGG + Intronic
1040570520 8:48605378-48605400 AATCATAAGGAGACTGTGAATGG + Intergenic
1044319261 8:90784315-90784337 AATGATGATCCTACTGTGCACGG + Intronic
1045992685 8:108328004-108328026 ATTGATTAGCACAGTGTCCATGG - Intronic
1045998560 8:108392520-108392542 AATGATATTTACACTGTGAATGG - Intronic
1046354524 8:113063564-113063586 GAAAATAAGCACACTGTTCAGGG + Intronic
1047608255 8:126495980-126496002 ACTGATATGCATACTCTGCATGG - Intergenic
1047804099 8:128341158-128341180 AGTTATAAGTACAATGTGCAGGG - Intergenic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1049297263 8:141848871-141848893 AATGATAAACTCACAGTTCAAGG - Intergenic
1050737591 9:8781695-8781717 AATCTTAATCAGACTGTGCAGGG + Intronic
1056768305 9:89458985-89459007 ACTCATACACACACTGTGCATGG + Intronic
1057207497 9:93182492-93182514 GATGATCAGCCCACTCTGCAGGG + Intergenic
1057405799 9:94769718-94769740 AATTGTAAGCACACTGGGGAGGG + Intronic
1058437610 9:104977490-104977512 AATAATAACCACTCTGTGCTAGG + Intergenic
1059751084 9:117247966-117247988 AATAAAAAGATCACTGTGCAGGG - Intronic
1060216578 9:121742130-121742152 AAAGATAGCCACACTGGGCAGGG + Intronic
1061835047 9:133323295-133323317 AAAGACAAGCAGACTATGCATGG + Intergenic
1186111846 X:6266138-6266160 AATGAGAAGCACATTTTTCATGG + Intergenic
1186118246 X:6328002-6328024 AAGAATCAGCACACTGTTCAAGG + Intergenic
1187451510 X:19401020-19401042 AATTCTAAGCAAACTGTGGATGG - Intronic
1187826735 X:23338715-23338737 AATGAAAAGCACACTGGGCTTGG - Intronic
1188847767 X:35095092-35095114 AATGATAAGCAAGTTGAGCAAGG + Intergenic
1189070871 X:37862483-37862505 CATGATAAACATACTGGGCAGGG + Intronic
1194404825 X:93483337-93483359 AAAGAGCAGCACATTGTGCAAGG + Intergenic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1202390353 Y:24363791-24363813 AATCATGAGCTCACTGTCCAAGG + Intergenic
1202480431 Y:25306325-25306347 AATCATGAGCTCACTGTCCAAGG - Intergenic