ID: 1184571429

View in Genome Browser
Species Human (GRCh38)
Location 22:45327469-45327491
Sequence GAGCCGTGACCTCAGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 192}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184571424_1184571429 8 Left 1184571424 22:45327438-45327460 CCGTGGCCTCTTGCTGACCTGGG No data
Right 1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1184571418_1184571429 27 Left 1184571418 22:45327419-45327441 CCTCACTCCTCTCCTGCCTCCGT 0: 1
1: 0
2: 6
3: 98
4: 1129
Right 1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1184571416_1184571429 29 Left 1184571416 22:45327417-45327439 CCCCTCACTCCTCTCCTGCCTCC 0: 1
1: 2
2: 24
3: 281
4: 2118
Right 1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1184571426_1184571429 2 Left 1184571426 22:45327444-45327466 CCTCTTGCTGACCTGGGACGTAC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1184571417_1184571429 28 Left 1184571417 22:45327418-45327440 CCCTCACTCCTCTCCTGCCTCCG 0: 1
1: 1
2: 6
3: 99
4: 1035
Right 1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1184571427_1184571429 -9 Left 1184571427 22:45327455-45327477 CCTGGGACGTACCTGAGCCGTGA 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1184571420_1184571429 20 Left 1184571420 22:45327426-45327448 CCTCTCCTGCCTCCGTGGCCTCT 0: 1
1: 1
2: 11
3: 118
4: 1029
Right 1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1184571421_1184571429 15 Left 1184571421 22:45327431-45327453 CCTGCCTCCGTGGCCTCTTGCTG 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1184571422_1184571429 11 Left 1184571422 22:45327435-45327457 CCTCCGTGGCCTCTTGCTGACCT 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184571429 Original CRISPR GAGCCGTGACCTCAGTGCTG TGG Intronic
900705939 1:4080184-4080206 CAGCTGTGACCTCATGGCTGAGG + Intergenic
901251757 1:7784455-7784477 GAGCCCTGCCCTCGGTACTGGGG + Intronic
901443857 1:9295053-9295075 GGCCCATGACCTCAGTGCTGGGG - Intronic
901510974 1:9717904-9717926 GATCCGGGACCGCAGAGCTGGGG + Intronic
904848609 1:33439927-33439949 CAGCCCTGAGCTAAGTGCTGAGG + Intergenic
904946141 1:34200099-34200121 AGGCCTTGACCTGAGTGCTGGGG - Intronic
907048428 1:51314067-51314089 CAGCCCTGACATCGGTGCTGAGG - Intronic
907403373 1:54239400-54239422 GTGCCGTGTCCACACTGCTGGGG - Intronic
912314525 1:108655257-108655279 GAGCCTTGGCCTCAGTGTTCTGG + Intronic
912625013 1:111199485-111199507 GAGCAGTGAGCTCAGAGCTCAGG + Intronic
916021619 1:160797369-160797391 GAGCCTAGACCTCAGAGCTGAGG + Intronic
916503812 1:165409577-165409599 GAGCAGTGCCCACAGTGCTGGGG - Exonic
916666273 1:166970575-166970597 GAGCCCTGACCTGGGAGCTGAGG - Intronic
916758526 1:167796226-167796248 AAGCCTTGCCCTCCGTGCTGTGG + Intergenic
916957696 1:169856598-169856620 GAGGCCTGGCCTGAGTGCTGGGG - Intronic
917527579 1:175802564-175802586 GAGCCCTGTCCTCAGAGGTGAGG + Intergenic
918204777 1:182299174-182299196 GAGGAGTGACCTCAGTACTAAGG + Intergenic
920190727 1:204191996-204192018 GGGCCGTGTCCTCTGTGCTCTGG + Intronic
920713698 1:208319396-208319418 GAGCTGAGACCTAAGTGATGAGG + Intergenic
922035202 1:221840952-221840974 GGGCAGTGATCTGAGTGCTGAGG + Intergenic
923085942 1:230703728-230703750 GGGCCCTGTGCTCAGTGCTGGGG - Intronic
1062936770 10:1396170-1396192 CAGCCAGGAGCTCAGTGCTGAGG - Intronic
1064783448 10:18868016-18868038 TTGCAGGGACCTCAGTGCTGTGG + Intergenic
1066444783 10:35472073-35472095 TAGCCCTGATCTAAGTGCTGTGG + Intronic
1067413361 10:46084535-46084557 GAGAGGTGACCTAAGTGATGTGG + Intergenic
1067931831 10:50569768-50569790 CAGCACTGACCTCAGTTCTGAGG - Intronic
1068591508 10:58857347-58857369 GAAGCCTGGCCTCAGTGCTGAGG - Intergenic
1071432966 10:85620537-85620559 TAGCCCTGAATTCAGTGCTGCGG + Intronic
1076340608 10:129742563-129742585 GAGCCAGGTCCTCAGGGCTGGGG + Intronic
1076340637 10:129742687-129742709 GAGCCAGGTCCTCAGGGCTGGGG + Intronic
1076566340 10:131402066-131402088 GAGCTGTGACCTCAGTGTGATGG + Intergenic
1076769491 10:132655278-132655300 GAGCCCTGTCTCCAGTGCTGTGG - Intronic
1077008559 11:370080-370102 CAGCCGAGACCTCTGTGCGGTGG - Intronic
1077180221 11:1208929-1208951 CAGGCGTGACCTCAGTGTGGCGG - Intergenic
1077180226 11:1208953-1208975 CAGGCGTGACCTCAGTGTGGCGG - Intergenic
1077180231 11:1208977-1208999 CAGACGTGACCTCAGTGTGGCGG - Intergenic
1077180235 11:1209001-1209023 CAGGCGTGACCTCAGTGTGGCGG - Intergenic
1078191027 11:9092217-9092239 GACCAGTGCCCTCAGGGCTGTGG - Intronic
1084678370 11:70650154-70650176 GAGCTGAAACCTCAGTGGTGAGG + Intronic
1085277113 11:75307332-75307354 GAGCCCTGACCTCTGTCCTCAGG - Intronic
1087177126 11:95106240-95106262 GAGCTGTGAGGTCAGAGCTGAGG + Intronic
1088808839 11:113375805-113375827 GAGCCCTGACATCACTGCTGGGG + Intronic
1089529293 11:119116245-119116267 GAGCTGGGTCCTCAGAGCTGGGG - Exonic
1091280978 11:134381497-134381519 CAGCCGTGGGCTCATTGCTGTGG + Intronic
1091290324 11:134435911-134435933 CAGCAGGGACCTCAGTGCTCTGG - Intergenic
1091335576 11:134763132-134763154 GAGCAGAGACCTCACTGATGGGG - Intergenic
1091831626 12:3554391-3554413 GAGCCCTGTGCTCAGTGCTGGGG + Intronic
1091837146 12:3594088-3594110 CAGCCCTGACCTCCCTGCTGGGG - Intergenic
1096217971 12:49808959-49808981 GGGAGGTGACCTCAGTGCAGGGG + Intronic
1096573354 12:52537477-52537499 GAGCTGTGTCCCCAGTGCTCTGG - Intergenic
1096974800 12:55693936-55693958 GAGCTGTGTCCCCAGGGCTGGGG - Intronic
1100565455 12:95790355-95790377 GAGCCGAGACCTCTGGGCTGCGG + Exonic
1102989189 12:117302654-117302676 GATTCCTGGCCTCAGTGCTGTGG + Intronic
1105202772 13:18194258-18194280 CAGGCGGGACCTCAGCGCTGTGG + Intergenic
1109703444 13:66057234-66057256 AAGACCTGACCTCAGAGCTGGGG - Intergenic
1112081234 13:95973275-95973297 CAGCCCTGATCTCAGTGATGGGG + Intronic
1117652200 14:57918746-57918768 GAGGCGTGACTTAGGTGCTGTGG + Intronic
1123174238 14:106401719-106401741 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1123182450 14:106482654-106482676 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1202944452 14_KI270726v1_random:14075-14097 GAGCCTTGACCTCAAAGCAGCGG + Intergenic
1123817173 15:23991879-23991901 CTGCAGTGACCTCACTGCTGTGG + Intergenic
1124044721 15:26138287-26138309 GATTTGTGTCCTCAGTGCTGGGG + Intergenic
1126104374 15:45138005-45138027 GAGCCGTGAGGTCCGAGCTGGGG + Exonic
1127656693 15:61062237-61062259 GAGCCGTCTCCCCAGTTCTGTGG - Intronic
1128677670 15:69623814-69623836 GAGCCCAGAGCCCAGTGCTGGGG - Intergenic
1128924010 15:71637421-71637443 GAGCCATGATCTCAGTGTCGTGG + Intronic
1128933711 15:71727884-71727906 GAGACTTAACCTCAGTGTTGGGG + Intronic
1129164704 15:73769986-73770008 GAGCCGGTACCTGACTGCTGGGG - Intergenic
1129313149 15:74726045-74726067 CCCCCGTGACCTCAGGGCTGGGG - Intergenic
1130576708 15:85099316-85099338 GAGCTGTGCAGTCAGTGCTGAGG - Intronic
1130613373 15:85380965-85380987 GCGCCGGGACCTCAGGTCTGCGG + Intronic
1131463857 15:92638909-92638931 GTACCGTCACCCCAGTGCTGTGG - Intronic
1132864405 16:2086410-2086432 GAGCCGTGCCCTGAGGCCTGGGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1137264817 16:46860029-46860051 TTGCCCTGACCTCAGTGATGTGG + Intergenic
1138261036 16:55622956-55622978 CAGCTGTGTCCTCAGAGCTGGGG - Intergenic
1139347615 16:66314350-66314372 GAGCTGTACACTCAGTGCTGTGG - Intergenic
1139386739 16:66577956-66577978 CAGACATGAGCTCAGTGCTGGGG + Intronic
1139949070 16:70660499-70660521 CAGCTGTGCCCTCACTGCTGCGG - Exonic
1141137625 16:81476944-81476966 GAGCCCTGACCTCCACGCTGGGG - Intronic
1141564646 16:84893139-84893161 GAGCAGTGTCCCCAGTGCAGCGG - Intronic
1141990815 16:87608501-87608523 GAGCCAGGACCCCAGTGCAGCGG - Intronic
1142195765 16:88738650-88738672 CAGCCGTGACCTCCGTGTAGGGG + Exonic
1147218741 17:38915767-38915789 GAGCCGGGACTTCAGCTCTGAGG - Intronic
1149020860 17:51962430-51962452 GAGCTGTCTCCTCAGTCCTGAGG - Intronic
1150618272 17:66789113-66789135 CAGCCTTGTCCTCAGTCCTGTGG + Intronic
1151314282 17:73312092-73312114 GCGCCGTGACATCAGCGCAGAGG - Exonic
1155058790 18:22210193-22210215 GATCCATGACCTTGGTGCTGTGG + Intergenic
1155092516 18:22525481-22525503 CATCGGTGACCTCAGTGCTGTGG + Intergenic
1158944726 18:62438327-62438349 GAGCCATGAGCCCTGTGCTGGGG + Intergenic
1160124202 18:76155423-76155445 GAGCCCTGTCCTTAGTGCTCTGG + Intergenic
1160241310 18:77124994-77125016 GAGCCGGGACCTCAGAGGAGTGG - Intronic
1162969075 19:14169454-14169476 CAGCCGTGTCCCCAGTGCTGTGG + Intronic
1163627178 19:18396995-18397017 TAGCCCTGACCTCAGCCCTGTGG + Exonic
1163819238 19:19486790-19486812 GAGGTGAGACTTCAGTGCTGAGG - Intronic
1167705343 19:51078290-51078312 GGGCTGAGACCTCAGAGCTGGGG - Intronic
925262444 2:2540295-2540317 CAGGCGTGACCACAGTACTGGGG + Intergenic
925435358 2:3832736-3832758 GAGCCCTGCGCTCAGTGCTGGGG - Intronic
927569336 2:24144682-24144704 GAGCCGTGGCCCCTGTGCTGAGG - Intronic
929314416 2:40460475-40460497 GAGCCATGAACTAAGTTCTGTGG + Intronic
933596482 2:84288448-84288470 GAGGGGTGACCTTACTGCTGAGG - Intergenic
933909518 2:86927596-86927618 GAGGCCTGAACTGAGTGCTGTGG + Intronic
934023207 2:87975783-87975805 GAGGCCTGAACTGAGTGCTGTGG - Intergenic
934736531 2:96692476-96692498 GAGGCGTGACCCCAGTGCTGTGG + Intergenic
936077401 2:109410392-109410414 CAGCCCTGACCTCGGTGCGGAGG + Intronic
936413347 2:112280622-112280644 GAGGCCTGAACTGAGTGCTGTGG + Intronic
937114735 2:119397186-119397208 GGGCCTGGCCCTCAGTGCTGGGG - Intergenic
942713580 2:178865589-178865611 GAGCAGTGACCTCAGGGATCTGG - Intronic
943724583 2:191239841-191239863 GAGCTGTCACCTCATTGCTGGGG - Intergenic
944595579 2:201257770-201257792 GGTCTGTGACTTCAGTGCTGAGG + Intronic
946202083 2:218076364-218076386 GGGCAGAGACCCCAGTGCTGGGG - Intronic
948265724 2:236633987-236634009 CAGCCCCGACCTCAGAGCTGAGG - Intergenic
1172572592 20:35982196-35982218 GGGCCATGAGCTCAGAGCTGGGG + Intronic
1173502602 20:43565139-43565161 GAGCTGTGAGCTCTGTGCTGGGG + Intronic
1174686178 20:52457397-52457419 AGTCAGTGACCTCAGTGCTGAGG - Intergenic
1175524911 20:59627036-59627058 CAGCCATGAGCCCAGTGCTGTGG + Intronic
1176183910 20:63767600-63767622 TTGCTTTGACCTCAGTGCTGCGG - Intronic
1178826816 21:36024280-36024302 CAACCTTGACCTCAGTGCTGTGG + Intergenic
1178889379 21:36508664-36508686 GAGCAATGGCCTCAGTGCTCCGG - Intronic
1180183284 21:46127416-46127438 GAGCCGTGGACTCAGAGCCGAGG + Intronic
1180189297 21:46154936-46154958 GAGCCTGGACCTCAGGGCTGTGG + Intronic
1180603167 22:17036208-17036230 CAGGCGGGACCTCAGCGCTGTGG + Intergenic
1180875461 22:19173112-19173134 CAGCCTTGTCCTCACTGCTGTGG - Intergenic
1181358764 22:22318981-22319003 GAGCAGTGGCTTCAGTGTTGGGG + Intergenic
1182101902 22:27663292-27663314 GAGAGGTGACCTCTGAGCTGGGG - Intergenic
1182683401 22:32100947-32100969 GATCTGTGTCCACAGTGCTGTGG + Intronic
1183592336 22:38787043-38787065 GAGCCGTGATCTAAGGGCCGCGG - Intronic
1183708049 22:39487143-39487165 CGGCGGTGTCCTCAGTGCTGGGG + Intronic
1184099728 22:42335826-42335848 GGGGCGTGATCTGAGTGCTGGGG - Intronic
1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG + Intronic
1184983676 22:48114724-48114746 GTGCGGTGGCTTCAGTGCTGCGG - Intergenic
1185176748 22:49331985-49332007 GACCCGGGTCCTCAGTCCTGTGG - Intergenic
1185223485 22:49640514-49640536 GGCCCTTGACCTCCGTGCTGTGG - Intronic
950967652 3:17156996-17157018 GAGGCTGGACCACAGTGCTGGGG + Intergenic
961203951 3:125066228-125066250 CAGCCCTGTCCTCAGTGCTCTGG + Intergenic
964616528 3:158672486-158672508 GAGCAGTGACTTCAGGGCTTGGG + Exonic
968746676 4:2364097-2364119 GAGCTGTGACCTGAGGCCTGGGG - Intronic
970937062 4:21585126-21585148 GTTCAGTGACCCCAGTGCTGGGG + Intronic
978721425 4:111914701-111914723 GTGCTTTGAGCTCAGTGCTGTGG - Intergenic
983040069 4:162914730-162914752 GAGCTGTGACCACAGTGTTCAGG - Intergenic
984964274 4:185127475-185127497 GTGCCGGGAACTGAGTGCTGCGG - Intergenic
985761192 5:1749757-1749779 GAACCATGACCACAGTGCTGTGG + Intergenic
985931684 5:3063315-3063337 GAGCTGTGTTCTCAGTGCAGTGG + Intergenic
998415154 5:141940769-141940791 GGGCCTTGCACTCAGTGCTGGGG - Exonic
999080614 5:148840037-148840059 GAGCTGTAGCTTCAGTGCTGGGG - Intergenic
999240959 5:150127131-150127153 GAGAAGTGGCCTCCGTGCTGAGG - Intronic
1002163195 5:177328999-177329021 GGGCCGTGACCACAGTGGGGTGG - Intergenic
1002965926 6:1966555-1966577 TAGCCCTGGGCTCAGTGCTGAGG + Intronic
1003103249 6:3193627-3193649 GATCCGGGAGCTCAGTGCTGAGG + Intergenic
1004544323 6:16582658-16582680 GTGCTGTGACCTCAGATCTGTGG - Intronic
1004722315 6:18277827-18277849 CAGCCCTGACCTCAGAGCCGGGG - Intergenic
1005209421 6:23443372-23443394 GACCCGTCTCCTCAGGGCTGGGG - Intergenic
1005387135 6:25296327-25296349 GAGCCCTGTCCTCCTTGCTGAGG + Intronic
1005529493 6:26688699-26688721 GGTCCTTGACCTCAGTGGTGAGG - Intergenic
1005541303 6:26812947-26812969 GGTCCTTGACCTCAGTGGTGAGG + Intergenic
1005990322 6:30898217-30898239 GAGCCGGAACCTCTATGCTGGGG + Exonic
1007991122 6:46257155-46257177 CAGCAGTGACCTCAGTACTCAGG + Intronic
1009012106 6:57855011-57855033 GGTCCTTGACCTCAGTGGTGAGG + Intergenic
1009017087 6:57918304-57918326 GAGCTGTAGCCTCAGTGCAGTGG - Intergenic
1010480248 6:76342974-76342996 GTCCAGTGACCTCATTGCTGTGG - Intergenic
1017000202 6:149991131-149991153 GAGACGTGACCTTACAGCTGGGG + Intergenic
1019074944 6:169379584-169379606 GAGCAGCGCCCTCAATGCTGTGG + Intergenic
1021036213 7:15802280-15802302 CCGCTGTGACCTAAGTGCTGTGG - Intergenic
1022485051 7:30771544-30771566 GAGCCGTTACCTTTCTGCTGAGG - Exonic
1022560088 7:31338614-31338636 GAGTGGTGAGCTCAGGGCTGTGG + Exonic
1023302825 7:38792142-38792164 GAGCCCAGACCACAGAGCTGAGG - Intronic
1023825318 7:44005020-44005042 GAGAAGGGACCTCAGTGTTGGGG - Intronic
1026088867 7:67283791-67283813 GAGAAGGGACCTCAGTGTTGGGG - Intergenic
1026725387 7:72866556-72866578 GAGAAGGGACCTCAGTGTTGGGG + Intergenic
1026747475 7:73024416-73024438 GAGAAGGGACCTCAGTGTTGGGG + Intergenic
1026751125 7:73052555-73052577 GAGAAGGGACCTCAGTGTTGGGG + Intergenic
1026754774 7:73080669-73080691 GAGAAGGGACCTCAGTGTTGGGG + Intergenic
1026758426 7:73108703-73108725 GAGAAGGGACCTCAGTGTTGGGG + Intergenic
1027088979 7:75284782-75284804 GAGAAGGGACCTCAGTGTTGGGG - Intergenic
1027092622 7:75312710-75312732 GAGAAGGGACCTCAGTGTTGGGG - Intergenic
1027096265 7:75340677-75340699 GAGAAGGGACCTCAGTGTTGGGG - Intergenic
1027118458 7:75499109-75499131 GAGAAGGGACCTCAGTGTTGGGG - Intergenic
1027273342 7:76536357-76536379 GAGAAGGGACCTCAGTGTTGGGG + Intergenic
1027323077 7:77027015-77027037 GAGAAGGGACCTCAGTGTTGGGG + Intergenic
1027326786 7:77055421-77055443 GAGAAGGGACCTCAGTGTTGGGG + Intergenic
1029719031 7:102350913-102350935 GAGAAGGGACCTCAGTGTTGGGG + Intergenic
1029753583 7:102558345-102558367 GAGAAGGGACCTCAGTGTTGGGG - Intronic
1029771531 7:102657429-102657451 GAGAAGGGACCTCAGTGTTGGGG - Intronic
1035029359 7:155847410-155847432 GAGCCGTGACTGCAGGGCCGAGG + Intergenic
1035260802 7:157660390-157660412 CAGCAGGGACCTCAGTCCTGTGG - Intronic
1035607853 8:940828-940850 GAGCAGAGACCTCAGTGAGGTGG - Intergenic
1035672959 8:1434115-1434137 GAGACGTGGCCGCAGGGCTGAGG + Intergenic
1038479283 8:27890705-27890727 GAGCTGTGGCCTCCGTGCTGGGG - Intronic
1039804230 8:40984889-40984911 GAGCCCTGTCCACAGTGCAGGGG - Intergenic
1040483998 8:47853325-47853347 GACACATGACCTCAGGGCTGAGG - Intronic
1041989679 8:63971673-63971695 GCCCCATGACCTTAGTGCTGTGG - Intergenic
1045297860 8:100888042-100888064 CAGCCTTGCCCTGAGTGCTGGGG - Intergenic
1049520813 8:143089245-143089267 GATCCCTGCCCTCAGTGTTGTGG - Intergenic
1049658681 8:143810085-143810107 GAGCTGTGACATGCGTGCTGTGG - Intronic
1050545222 9:6703948-6703970 GAGCGGTGACCTCAGAGGCGCGG - Intergenic
1050546764 9:6716122-6716144 GAGCCGTGACGTCAGAGGCGGGG - Intergenic
1056560131 9:87722865-87722887 GAGTCATGACCCAAGTGCTGGGG - Intergenic
1057007435 9:91573083-91573105 GAGCTGAGGCCCCAGTGCTGTGG + Intronic
1057477214 9:95412767-95412789 GAGCCCTTACCTCCCTGCTGTGG - Intergenic
1057702772 9:97375787-97375809 GAGGCGTGATCCCAATGCTGTGG + Intronic
1057719633 9:97521478-97521500 GATCCATGATCTCTGTGCTGGGG - Intronic
1057800286 9:98186867-98186889 GGGCAGTGAGCTCAGTGCTAGGG - Intronic
1058158682 9:101543728-101543750 TAGCCCTGTCCTCAGTGCTTAGG + Intronic
1061211029 9:129193556-129193578 CAGCCATGGCCTCAGTGCTGCGG + Intergenic
1061587261 9:131577117-131577139 GAGCTCTGTGCTCAGTGCTGCGG - Exonic
1185460863 X:332289-332311 GCCCCGGGACCTCAGGGCTGTGG + Intergenic
1185948142 X:4401178-4401200 GTGCTGTAACCTCAGTCCTGGGG + Intergenic
1190719467 X:53135436-53135458 AATTCGTGACCTCAGTGTTGAGG - Intergenic
1193486175 X:82087463-82087485 GAGCTGTGAAATCAGTGATGGGG - Intergenic
1195362685 X:104099739-104099761 GAGCGGTGTCATCAGTGGTGGGG + Exonic
1196365946 X:114924596-114924618 GAGCTCTGACATCTGTGCTGAGG + Intergenic
1201735509 Y:17256556-17256578 GTGCTGTAACCTCAGTCCTGGGG + Intergenic