ID: 1184579022

View in Genome Browser
Species Human (GRCh38)
Location 22:45400173-45400195
Sequence CACACCTACCACCTAGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 3, 2: 9, 3: 68, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184579020_1184579022 9 Left 1184579020 22:45400141-45400163 CCTAGAAGCAAGGACACTCCAGT 0: 1
1: 3
2: 42
3: 134
4: 430
Right 1184579022 22:45400173-45400195 CACACCTACCACCTAGATGTTGG 0: 1
1: 3
2: 9
3: 68
4: 255
1184579021_1184579022 -9 Left 1184579021 22:45400159-45400181 CCAGTAGCAACGAACACACCTAC 0: 1
1: 1
2: 14
3: 76
4: 264
Right 1184579022 22:45400173-45400195 CACACCTACCACCTAGATGTTGG 0: 1
1: 3
2: 9
3: 68
4: 255
1184579018_1184579022 25 Left 1184579018 22:45400125-45400147 CCAACAGCTGAGAAAGCCTAGAA 0: 1
1: 0
2: 6
3: 28
4: 227
Right 1184579022 22:45400173-45400195 CACACCTACCACCTAGATGTTGG 0: 1
1: 3
2: 9
3: 68
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184579022 Original CRISPR CACACCTACCACCTAGATGT TGG Intronic
900072571 1:784420-784442 CACACCTGCTACCTAGAACTTGG + Intergenic
900763139 1:4486380-4486402 GCCACCCACCACCCAGATGTAGG - Intergenic
901588372 1:10317490-10317512 CATACTTAGCACCTAGATCTTGG - Intronic
902836688 1:19051937-19051959 CACACCTGGCACCCAGATGTTGG - Intergenic
904999738 1:34658810-34658832 CACACCTAACACCTAGGTCTTGG + Intergenic
905487237 1:38310756-38310778 CACACCTAATGCCTAGATCTTGG - Intergenic
906570398 1:46833110-46833132 CACACCTAACACTCAGATCTTGG - Intergenic
909254996 1:73408571-73408593 CACACCTAGCACCCAGAGATTGG + Intergenic
909305009 1:74062824-74062846 CACACCCACCACCTTCAAGTAGG - Intronic
909953657 1:81750934-81750956 CACACCTACATCCCAGATCTTGG + Intronic
910400350 1:86831931-86831953 TACACCTACTACCCAGATGTTGG + Intergenic
910909724 1:92220219-92220241 TACACCTAGCACCCAGATTTTGG - Intronic
910987494 1:93020006-93020028 GACACCTACCATCCAGATCTCGG + Intergenic
911113777 1:94221823-94221845 CACACCTAGTATCTAGATCTTGG + Intronic
911946180 1:104112376-104112398 CATACCTACCACCTGAATTTTGG - Intergenic
912418058 1:109524236-109524258 CACACCAAGCACCCAGATTTTGG + Intergenic
912517066 1:110223130-110223152 CACACATACGCCCTCGATGTAGG - Exonic
914257572 1:145973160-145973182 CACACCTAGCACCCAGATCTTGG - Intronic
918240111 1:182613455-182613477 CACACCTTCCTTCTGGATGTGGG + Intergenic
918792896 1:188853525-188853547 CACACTTAGCACCCAGATCTTGG - Intergenic
918962593 1:191299836-191299858 TATACCCACCACCTAGATGACGG - Intergenic
922011212 1:221590100-221590122 CATACCTACCACTCAGGTGTTGG + Intergenic
922268153 1:224007344-224007366 CACACCTGCTACCTAGAACTTGG + Intergenic
923784677 1:237055479-237055501 CACAACTACCACCCAAATTTAGG - Intronic
924058156 1:240143827-240143849 CACACCTGCCACCTCCATGCTGG + Intronic
924616129 1:245613473-245613495 CACACCTCCCAGCTAGTTGGGGG + Intronic
1063293509 10:4776927-4776949 CATACCTAGCACCTAGATCTTGG + Intergenic
1065191003 10:23209016-23209038 AAGACCCACCACCTAGATGAAGG + Intronic
1065203483 10:23336469-23336491 CACATCTAACACTCAGATGTTGG + Intronic
1065464499 10:26004540-26004562 CACATCTAGCACCTAGCTTTTGG + Intronic
1065896545 10:30167792-30167814 CACACCCAGCACCTAGATTGTGG - Intergenic
1067395095 10:45908318-45908340 CACACCTATCACCTAGATGTTGG + Intergenic
1067487693 10:46666931-46666953 TACACCTAGCACCTAGATCTTGG + Intergenic
1067607113 10:47675071-47675093 TACACCTAGCACCTAGATCTTGG - Intergenic
1067863412 10:49877450-49877472 CACACCTATCACCTAGATGTTGG + Intronic
1067935193 10:50605200-50605222 CTCCCCTACCACCCAGATTTGGG + Intronic
1068646048 10:59469745-59469767 CACACCTAGCACCCAAATCTTGG + Intergenic
1069677992 10:70262848-70262870 CACACCTAGAACCCAGATCTTGG + Intronic
1070242925 10:74701391-74701413 CACAGCTGCCACCCAGATCTTGG + Intronic
1071258202 10:83894119-83894141 CACAGCTACCATGTACATGTAGG - Intergenic
1071622672 10:87136442-87136464 TGCACCTAGCACCTAGATCTTGG - Intronic
1072749518 10:97967462-97967484 CACACCTAGCCCCCAGATCTTGG - Intronic
1074643289 10:115413816-115413838 CATACCTAGCACCAAGATCTTGG - Intronic
1074714364 10:116204433-116204455 CACACCTAACACCCAGATCTTGG + Intronic
1075308142 10:121386255-121386277 CACACTTATCACCCAGATATTGG + Intergenic
1075842958 10:125519547-125519569 CACACCCAGCACCTAGATATTGG + Intergenic
1076286464 10:129302468-129302490 CACACCTAGCAACCAGATCTTGG + Intergenic
1080851706 11:36076074-36076096 CACACCTAGCACCCAGATCTTGG - Intronic
1086984123 11:93229924-93229946 CACTCCTAGCACCTAGATCTTGG - Intergenic
1087761520 11:102108735-102108757 AACACCTACCTCATAGTTGTTGG - Intergenic
1088797520 11:113276187-113276209 AACAAATACCACCTAGAGGTAGG + Exonic
1089069465 11:115688354-115688376 CACACCCACCACCTACCTGCAGG - Intergenic
1089380962 11:118031295-118031317 CACATCTACCACTAAGATCTTGG + Intergenic
1090730523 11:129569807-129569829 CACACTTAGCACCCAGATCTTGG + Intergenic
1091148985 11:133308660-133308682 CACACCCAGCACCAAGATCTTGG + Intronic
1091769790 12:3143905-3143927 CGCACCTAGCACCTAGATCTTGG - Intronic
1093134310 12:15432151-15432173 CTCACCCACCACCCTGATGTAGG + Intronic
1093164069 12:15785648-15785670 CACACCTAGCACCCAGATCTTGG + Intronic
1094778177 12:33757109-33757131 CACACCTGGCACCTAGAGCTTGG - Intergenic
1095753936 12:45741804-45741826 CACACCTATCACCTCGATCTTGG - Intronic
1095781311 12:46063639-46063661 CACACCCAGCACCCAGATCTTGG + Intergenic
1095943381 12:47740296-47740318 CACACTTACCTCCCAGGTGTGGG + Exonic
1096172809 12:49486812-49486834 CACACCTAGCTCCTAGATACTGG - Intronic
1097230781 12:57509319-57509341 CACATCTACCACCTAGATTTTGG - Intronic
1098705066 12:73676793-73676815 CACACCTAGCTCCCAGATCTTGG + Intergenic
1102125763 12:110479213-110479235 CACACCTAGCACCCAGATCTTGG - Intronic
1102378698 12:112444966-112444988 CACACCTAACACCTCTATCTTGG - Intronic
1102580640 12:113884606-113884628 CACACCTGGCACCCAGATCTTGG + Intronic
1103166793 12:118776898-118776920 CACTCCCACCACCCAGATGATGG - Intergenic
1104221497 12:126788815-126788837 CAAGCCTACCAACTTGATGTGGG + Intergenic
1104997702 12:132668851-132668873 CTCATCTACCACCTGGACGTGGG - Exonic
1108489081 13:50961649-50961671 CATACCTACTGCCTAGATCTTGG - Intronic
1108615858 13:52131431-52131453 CACACCCAGCACCCAGATCTTGG + Intergenic
1110338463 13:74360744-74360766 CATACCTAGCACCTAGATCTTGG - Intergenic
1110542185 13:76719036-76719058 CACTACTACCACCTCCATGTTGG + Intergenic
1111075363 13:83228653-83228675 CAACCCTACGTCCTAGATGTAGG - Intergenic
1112700461 13:102001881-102001903 CCCACCTGCCACCTAAATGAGGG - Intronic
1113011350 13:105770629-105770651 CACACCTACCTCCTAGATCTTGG - Intergenic
1115644545 14:35359293-35359315 CACATCTAGCACCCAGATCTTGG + Intergenic
1117287871 14:54304901-54304923 CACATCTAACACCCAGATCTTGG - Intergenic
1117388666 14:55241943-55241965 CACACCCAGCACCCAGATGGAGG - Intergenic
1117414552 14:55481696-55481718 CACATCTAGCACCCAGATCTTGG + Intergenic
1118400089 14:65371823-65371845 CACATCTAGCACCCAGATCTCGG - Intergenic
1121115878 14:91342371-91342393 CGCACCTACCTCCTGGATATGGG + Exonic
1121707809 14:96012326-96012348 CTCACTTATCACCAAGATGTTGG + Intergenic
1123458471 15:20446534-20446556 CACACCTACCACCTAGGGAATGG - Intergenic
1123659592 15:22553875-22553897 CACACCTACCACCTAGGGAATGG + Intergenic
1124313455 15:28648370-28648392 CACACCTACCACCTAGGGAATGG + Intergenic
1124508754 15:30304284-30304306 CAAGCCTGCCACCTAGATGCAGG + Intergenic
1124734804 15:32234378-32234400 CAAGCCTGCCACCTAGATGCAGG - Intergenic
1125225710 15:37393376-37393398 CACACCTAACACCCAGATCTTGG - Intergenic
1126434344 15:48620797-48620819 CACACCTAATGCCTAGATCTTGG + Intronic
1127322499 15:57860911-57860933 CACACCTAGCACCCAGATCTTGG - Intergenic
1127583831 15:60362876-60362898 CACACCCAAAACCTAGATCTTGG - Intronic
1128626650 15:69214157-69214179 CATACCTAGCACCCAGATGCTGG - Intronic
1128807912 15:70547045-70547067 CACAGCTACCACCCAGATCTTGG + Intergenic
1132329975 15:101005570-101005592 CACACCTCACACCCAGATCTTGG + Intronic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1134139307 16:11703665-11703687 CATACCTAGCACGTAGATCTTGG + Intronic
1134324549 16:13195123-13195145 CACACCTGGCACCTAGATTTTGG + Intronic
1134417450 16:14056637-14056659 CACACCTACCACTCAGATCTTGG - Intergenic
1134768144 16:16780565-16780587 CACACCTCCCTCCCAAATGTGGG - Intergenic
1135509938 16:23073717-23073739 CTCACCTGCCACCGAGCTGTTGG + Exonic
1138229739 16:55328281-55328303 CACACCTAATACCTAAATGATGG + Intronic
1139359517 16:66388829-66388851 CATTCCTACCTCCTAGATGAGGG - Intronic
1140909705 16:79440128-79440150 CACCACTACCACCTGGATGCAGG + Intergenic
1141755119 16:85985900-85985922 CACACCGACCACCTCGTGGTTGG - Intergenic
1141825703 16:86478329-86478351 CACAGCTGCCACCAAGATGGAGG + Intergenic
1143095982 17:4478624-4478646 CACACCTACCAGCAGGATGTCGG - Exonic
1143245099 17:5477912-5477934 CACATCTAGCACCCAGATCTTGG + Intronic
1144277458 17:13687441-13687463 CACATCTAGCATCTAGATTTTGG - Intergenic
1146966199 17:37032542-37032564 CACCCCTAGTACCTAGATCTTGG - Intronic
1147225396 17:38972796-38972818 CACCAGTACCACCTAGATTTGGG - Intergenic
1149619149 17:58029113-58029135 CACACCTAGCACCCAGATCTTGG + Intergenic
1150947064 17:69759230-69759252 GTAACCTACCACCTATATGTGGG + Intergenic
1151805683 17:76403696-76403718 CACACCTAGCATCCAGATCTTGG + Intronic
1152607585 17:81300468-81300490 CACACCCAGCACCCAGATCTCGG - Intergenic
1153867077 18:9280452-9280474 CACACATACCAACTATTTGTGGG - Intronic
1154936388 18:21062128-21062150 CACACCTAGCACCCAGATCTTGG + Intronic
1155841021 18:30642819-30642841 CACACTTACCACCAAGAACTTGG + Intergenic
1157020021 18:43770022-43770044 CACACCTAATACCTAGATCTTGG + Intergenic
1157234061 18:45946787-45946809 CACTCCCATCACTTAGATGTAGG + Intronic
1157433625 18:47651083-47651105 CACACCTCCCACCTGCCTGTGGG - Intergenic
1157876694 18:51280490-51280512 CACACCTGCCATTTTGATGTGGG - Intergenic
1158711378 18:59841157-59841179 CACACCTAGCACCCCGATCTTGG + Intergenic
1164255154 19:23521628-23521650 CAGTCATACCACCTAGGTGTTGG + Intergenic
1167289190 19:48615163-48615185 AACACCTGCCACCTGGCTGTTGG + Intergenic
925520790 2:4742714-4742736 CACACCTAGTACCCAGATCTTGG + Intergenic
926239209 2:11072035-11072057 CACACCTAGCACCCAGACTTTGG + Intergenic
926294953 2:11562452-11562474 CTCGGCTACCACCTAGATGCGGG - Exonic
926397432 2:12458218-12458240 CACACCTGACACCTAGAAATTGG + Intergenic
926555762 2:14356072-14356094 CACACCTATCACCCAGATCTTGG + Intergenic
927487991 2:23502446-23502468 CACACCTACCACCCACCTTTTGG + Intronic
927659146 2:24977510-24977532 AACACCTAGCACCCAGATCTTGG - Intergenic
928599289 2:32887405-32887427 CACCCCTAGCACCCAGATCTTGG + Intergenic
929912604 2:46103382-46103404 CACACTTCGCACCTAGATTTTGG - Intronic
931050119 2:58403991-58404013 CACACCTAACACCTAGATCTTGG + Intergenic
931199397 2:60082900-60082922 CACACCCAGTACCTAGATCTTGG + Intergenic
932311092 2:70741890-70741912 CACACATCCCACCCAGCTGTGGG + Intronic
932361662 2:71113377-71113399 CACACTTAGAACCTAGATCTTGG + Intronic
933521205 2:83376524-83376546 CACACCTAAGACCTAAATCTTGG - Intergenic
934105003 2:88687466-88687488 CAGAGCTACAAACTAGATGTTGG - Intergenic
934928537 2:98400064-98400086 CACACCAAGCACCCAGATCTTGG + Intergenic
935140774 2:100350990-100351012 CACAGTTACCACCTACATGGAGG + Intergenic
936653995 2:114463077-114463099 CACACCCAGCACCAAGATCTTGG - Intronic
939733242 2:145811343-145811365 CACAACTACCACATATATTTAGG - Intergenic
940079605 2:149785433-149785455 CACCCTTACCACCCAGATCTTGG - Intergenic
940732526 2:157409110-157409132 CACACATAGCACCAAGATCTTGG - Intergenic
941946758 2:171107523-171107545 CATAACTAGCACCTAGATGTTGG + Intronic
942027869 2:171928226-171928248 TTCACCTAGCACCTAGATCTTGG - Intronic
942233937 2:173886015-173886037 CACACCTACCACCCAGATCTTGG + Intergenic
943431696 2:187810653-187810675 CACACCTGGCACCTAGATATTGG + Intergenic
944609809 2:201391088-201391110 CACACCTAACACCCAGATCTTGG + Intronic
945866562 2:215182564-215182586 CAAACCTACCCCCAAGAAGTGGG - Intergenic
946314488 2:218901032-218901054 CACATCTAGCACCCAGATCTTGG - Intergenic
946529331 2:220554788-220554810 CACATCTAATACCCAGATGTTGG + Intergenic
946799296 2:223393038-223393060 CACACTTAGCACCCAGATCTTGG - Intergenic
948067322 2:235090857-235090879 CACACTTGCCACCTAGACTTTGG + Intergenic
1168798088 20:625342-625364 CATTCCTCCCATCTAGATGTAGG + Intergenic
1168808998 20:690935-690957 TACACCTAACACCTAGATCTTGG + Intergenic
1169155607 20:3327285-3327307 CATCCCTACCCACTAGATGTTGG + Intronic
1170101361 20:12703138-12703160 CACACCTATGACCCAGATATTGG - Intergenic
1170269126 20:14504173-14504195 GGCACCTACCAACTAGCTGTTGG + Intronic
1170286256 20:14712957-14712979 AACACCTAACAACAAGATGTTGG - Intronic
1173644649 20:44625884-44625906 CACACCTCCCACTAAGATCTAGG - Intronic
1173757638 20:45531988-45532010 CTCACCTTCCACCTAGAAGTGGG - Intergenic
1174108815 20:48183554-48183576 CTCACCAACCACCTAGCCGTAGG + Intergenic
1174420716 20:50397354-50397376 CACAGCTACCACCGAGGTGCAGG + Intergenic
1174728187 20:52887482-52887504 CACACCTAGCACCTAGATCTTGG + Intergenic
1175369483 20:58478291-58478313 CACACCTAGCACCCAGATCTTGG - Intronic
1176122217 20:63459030-63459052 CCCACCCACCAACTGGATGTTGG - Intronic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1178630419 21:34254861-34254883 CACACCTACCACCTAGATCTTGG - Intergenic
1178700670 21:34831035-34831057 CACAACTCCCACCTAGAGATGGG - Intronic
1181722616 22:24787506-24787528 CACACCCAGCACCCAGATCTTGG + Intergenic
1183144607 22:35978457-35978479 CATACCCACCACCCAGATGTTGG + Intronic
1184579022 22:45400173-45400195 CACACCTACCACCTAGATGTTGG + Intronic
949196009 3:1308456-1308478 CACACCTAGTACCCAGATATTGG - Intronic
949529798 3:4944589-4944611 CACACCTTCCACCTATACCTTGG + Intergenic
949922883 3:9017149-9017171 CACACCTAATACCTAGATCTTGG - Intronic
950268838 3:11596882-11596904 AACACCTAGCACCTGGATCTGGG + Intronic
950523173 3:13508281-13508303 AGCACCTACCTCCTAGGTGTTGG + Intergenic
952173591 3:30836482-30836504 CAAACCTATCACCTAAATGATGG + Intronic
952575601 3:34770525-34770547 CACACTTACCACTTAGATCATGG - Intergenic
952686655 3:36157619-36157641 CACACCTAGTACCCAGATCTTGG + Intergenic
953648675 3:44779339-44779361 CACACCTAGCGCCCAGATCTTGG - Intronic
955596181 3:60593076-60593098 CACATTTTCCCCCTAGATGTTGG - Intronic
956236230 3:67074457-67074479 CACACCTAGCACACAGATGATGG + Intergenic
956646613 3:71463430-71463452 CACACCTACCACATGGCTATGGG + Intronic
956660236 3:71590400-71590422 CACACCTAGCACCCAGATCTTGG + Intergenic
956819611 3:72941917-72941939 CACACCTAGCACCTAGATATTGG + Intronic
957583162 3:82102738-82102760 CACACTTAACATCCAGATGTTGG - Intergenic
959007267 3:101034506-101034528 AAAACCTGCCACCTAGATGAGGG - Intergenic
960251061 3:115453917-115453939 TACATCTACCACCAAGATCTTGG - Intergenic
961073420 3:123959730-123959752 CACATCTAGTACCTAGATCTTGG - Intronic
961310158 3:125992088-125992110 CACATCTATTACCTAGATCTTGG + Intergenic
961857612 3:129888417-129888439 CACACCTATCACCCAGATCTTGG + Intronic
961966149 3:130905147-130905169 CACACCTGGCACCCAGATCTTGG - Intronic
962585235 3:136836040-136836062 CACACCTAGCATCCAGATCTTGG - Intronic
964238475 3:154562831-154562853 CACACCTAACACACAGATCTTGG - Intergenic
964865681 3:161257572-161257594 CATACTGAGCACCTAGATGTTGG - Intergenic
965112195 3:164441526-164441548 CACATCTACTACCTAGATCTTGG + Intergenic
966544219 3:181126561-181126583 CACACCTAGCACCGAGTTCTTGG - Intergenic
966685593 3:182691354-182691376 CACACCTAGCACCCAGATCTTGG + Intergenic
966873204 3:184305757-184305779 GACACCTGCCACCTAGAGGTAGG - Exonic
967267868 3:187706946-187706968 CACACCTACCACACACATCTGGG + Intronic
967327054 3:188251421-188251443 CACACCTAGCACTCAGATATTGG - Intronic
969367148 4:6702948-6702970 CACACCTAGCTCCCAGATCTTGG - Intergenic
970102262 4:12538141-12538163 TACAGCTCCCACGTAGATGTGGG + Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
973800774 4:54475645-54475667 CTCAATTACCACCTAGATGCAGG - Intergenic
974500466 4:62693772-62693794 CATACCTACCACCTAGGTCTTGG - Intergenic
974662328 4:64908223-64908245 CACAACTAACACCTAGATCTTGG - Intergenic
974861201 4:67523739-67523761 CACACCTAGCACTCAGATCTTGG + Intronic
975509479 4:75177906-75177928 CATACCTAGGACCTAGATCTGGG - Intergenic
975590050 4:75990743-75990765 CACTCCCACCTCCTCGATGTAGG + Exonic
981734424 4:147934284-147934306 CACATCAGCCACCTGGATGTTGG + Intronic
983926256 4:173405912-173405934 CACACCTAGCTCCCAGATCTTGG - Intronic
985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG + Intronic
986503220 5:8423401-8423423 CACATCTAGCACCCAGATCTTGG + Intergenic
986577585 5:9228683-9228705 CACACCTACTACCTTGGTCTAGG - Intronic
986882409 5:12190661-12190683 CACACCTAGTGCCTAGATGTTGG - Intergenic
986991896 5:13563911-13563933 CACACCTACTGCCCAGATATTGG + Intergenic
988058214 5:26129109-26129131 GCCACCTACCGCCAAGATGTTGG - Intergenic
989110047 5:37898532-37898554 CACACCTAGCACTCAGATATTGG - Intergenic
989467509 5:41774369-41774391 CACACCTAGCACCCAGATCTTGG + Intronic
990006359 5:50947964-50947986 TACACCTACAGCCTAGGTGTAGG + Intergenic
991988099 5:72310247-72310269 GACACCTAGCACCTAGATCTTGG + Intronic
992235357 5:74703467-74703489 CACACCTAGAGCCTAGATATTGG - Intronic
992685656 5:79197184-79197206 CAAACCTACCATCTAGATGCAGG + Intronic
993060463 5:83032463-83032485 AACACCTAGCACCCAGATCTTGG + Intergenic
994848142 5:105017103-105017125 CACACCCTCCACCTTCATGTAGG - Intergenic
995244373 5:109919871-109919893 CACACCTTCCACCCTTATGTAGG + Intergenic
995946619 5:117655067-117655089 CACATCTACCACCCAGTTATTGG - Intergenic
996384215 5:122893413-122893435 CACACCTACCACGCAGATCTTGG - Intronic
996433197 5:123403212-123403234 CATACCTAGCACCTAGATCTTGG + Intronic
997785818 5:136712400-136712422 CACACCTAGTACCCAGATCTTGG + Intergenic
998054065 5:139058885-139058907 CACACCTAGCATCCAGATCTTGG - Intronic
998145262 5:139724259-139724281 CACATCTGCCTCCTAGATGCTGG - Intergenic
998912901 5:146980223-146980245 CACATCTCCCAACTAGATGTTGG + Intronic
1000939529 5:167343321-167343343 CACATCCAGCACCCAGATGTTGG - Intronic
1001423564 5:171606559-171606581 CACAACTATCACCCAGATCTTGG - Intergenic
1002241146 5:177841483-177841505 CACACCTAGTACCCAGATCTTGG + Intergenic
1003027399 6:2567629-2567651 CACCCCTAGCACCCAGATCTTGG - Intergenic
1003139893 6:3462510-3462532 CACACCTAGCACCCAGATCTTGG + Intergenic
1003519427 6:6845317-6845339 TACACCTAGCACCCAGATCTTGG - Intergenic
1004218950 6:13728904-13728926 CACACTGAGCACCTAGATTTTGG - Intergenic
1004799260 6:19128149-19128171 CACACCTAGCACCAAGATCTTGG + Intergenic
1005176843 6:23056608-23056630 CACACCTAACTCCCAGATGTTGG + Intergenic
1005434103 6:25789080-25789102 CACATCTACCACTGAGATCTTGG + Intronic
1006142305 6:31937258-31937280 CCCACCTACCACCTAGGGGTAGG - Intronic
1007372526 6:41435742-41435764 CACACCTAGCACCCAGAGCTAGG - Intergenic
1008243453 6:49141990-49142012 CACACATAGCACCCAGATCTCGG - Intergenic
1009624125 6:66115689-66115711 CACACCTAGAGCCTAGATCTTGG - Intergenic
1009636642 6:66274461-66274483 CACTCCTCCCACCTGGATGTGGG + Intergenic
1010372109 6:75122370-75122392 CAAACGTACCACTCAGATGTGGG + Intronic
1011907960 6:92396092-92396114 CACATCTAGCTCCTAGATTTTGG - Intergenic
1012987457 6:105890101-105890123 CACACCTACCACCTAGATAGTGG + Intergenic
1014815495 6:125931467-125931489 GACACCTAGCCCCTAGATGTTGG + Exonic
1017919848 6:158861923-158861945 CACACCTATCACCAAAATCTTGG - Intergenic
1018441253 6:163815373-163815395 CACCCCTTCCACTTAAATGTTGG - Intergenic
1021362886 7:19738490-19738512 CACACCTATCACCCAGATCTTGG + Intronic
1022749360 7:33207640-33207662 CACACCTAGCATCTATATCTTGG - Intronic
1023095073 7:36652035-36652057 CATACCTAGCACCCAGATCTTGG + Intronic
1023561711 7:41480781-41480803 CACACCTGGCACCCAGATTTTGG + Intergenic
1023902697 7:44495840-44495862 CATACCTTCCACCCAGATCTTGG + Intergenic
1024568578 7:50705250-50705272 CACATCTACCACTTAGAAGGAGG + Intronic
1025250260 7:57347111-57347133 CACAGCTACCACCGAGGTGCAGG - Intergenic
1027541918 7:79477567-79477589 CACAGCTGCCAGCAAGATGTCGG - Intergenic
1027690989 7:81344455-81344477 GACACCTAGCACCTAGATCTTGG + Intergenic
1029224431 7:99014672-99014694 CACACCTTCCCCCTGGTTGTTGG + Intergenic
1031497132 7:122464030-122464052 CACACATGTCACCTAGATCTTGG + Intronic
1031929890 7:127674210-127674232 CACACCTAGTACCCAGATCTTGG - Intronic
1032650537 7:133873374-133873396 CACACCTCCCTCCTAGAGGATGG + Intronic
1035003806 7:155640253-155640275 CACACCCAGCACCTAGACCTTGG - Intronic
1038469802 8:27805602-27805624 CACACCTACCACCCAGATCTTGG + Intronic
1039590072 8:38738797-38738819 CACATCTAGCACCAAGATTTTGG - Intronic
1040574321 8:48637774-48637796 CACACCCAGCACCCAGATCTTGG - Intergenic
1040733386 8:50476748-50476770 CACACCTAGTACCTAGATCTTGG + Intronic
1042752820 8:72176675-72176697 CACACATAACCCCTAGATCTTGG - Intergenic
1043432016 8:80204439-80204461 CACACCTACCATCCAGATCTTGG + Intronic
1044708425 8:95031184-95031206 CACACCTAGCACCCAGATCTTGG - Intronic
1044751226 8:95417628-95417650 CACACCTACTACCCAGATATTGG - Intergenic
1045175030 8:99713690-99713712 CATACCTACCACCCAGATTTTGG + Intronic
1045273927 8:100684731-100684753 CACACCTGGCACCCAGATATTGG + Intergenic
1045415225 8:101959802-101959824 CACACCTAGTGCCCAGATGTTGG - Intronic
1045783339 8:105894207-105894229 CACATCTAGCACCCAGATTTCGG + Intergenic
1046406332 8:113777504-113777526 CACTTCTGCCACTTAGATGTAGG + Intergenic
1046594545 8:116246383-116246405 CAAACATACCACCTTGATGGGGG + Intergenic
1046846150 8:118919000-118919022 CACACCTAGCACCTTGATTGTGG + Intergenic
1047380101 8:124353549-124353571 CACACCTAACACCCAGATCTTGG + Intronic
1047587425 8:126288716-126288738 CACACCTACCAGTTGGATATAGG + Intergenic
1047767109 8:127999010-127999032 CACATCTAGCACCCAGATCTTGG - Intergenic
1047987731 8:130253124-130253146 CATAGCTACCAACTAGATGCTGG + Intronic
1048030115 8:130623221-130623243 CACATCTAGCACCTAGATCTTGG - Intergenic
1048388157 8:133933021-133933043 CACACCTAACACTCAGATCTTGG - Intergenic
1050070184 9:1802480-1802502 CACACTTAGCACCCAGATCTTGG + Intergenic
1050511949 9:6405702-6405724 CACTCCTCCCACTGAGATGTGGG + Intergenic
1051477796 9:17527693-17527715 CACACCTAGCACTCAGATTTTGG + Intergenic
1051733039 9:20167546-20167568 CACACCTAGCACCCAAATCTTGG + Intergenic
1053095546 9:35324832-35324854 GTCACCTATCACCTATATGTGGG + Intronic
1054740249 9:68799187-68799209 CACACCTTCCATCAATATGTTGG + Intronic
1057403840 9:94749436-94749458 CACAACTGGCACCTAGATCTTGG - Intronic
1057729819 9:97598610-97598632 CACATCTACCCCCAAGAAGTTGG + Intronic
1057841947 9:98493355-98493377 CACACCTAACACCCAGATTTTGG - Intronic
1057931757 9:99199744-99199766 CATGCCTAGCACCTAGATCTTGG - Intergenic
1058441763 9:105015255-105015277 CACACCTGCCACCCAGAACTTGG - Intergenic
1058528580 9:105884433-105884455 CCCACCTACCAGTTAGGTGTGGG + Intergenic
1058671887 9:107366983-107367005 CACTCCTACCACCTGGGTGAAGG + Intergenic
1059464235 9:114457169-114457191 TACACCTAGCACCTGGATCTTGG + Intronic
1060369456 9:123056119-123056141 CACACCTAGCATCTATATTTTGG - Intronic
1060626041 9:125112674-125112696 CACACCTAACACCTAGCTCTTGG + Intronic
1060729478 9:126028089-126028111 AAAAGCAACCACCTAGATGTAGG + Intergenic
1061285947 9:129622514-129622536 CACACCTAGCACCCAGACCTTGG - Intronic
1061320628 9:129826205-129826227 CACACCTAGCACCCAGACCTTGG - Intergenic
1061615431 9:131775853-131775875 AACACCCACCACTTACATGTTGG + Intergenic
1185446048 X:258468-258490 CACACCCACCCCATGGATGTGGG - Intergenic
1187564251 X:20432827-20432849 TAAATCTTCCACCTAGATGTTGG - Intergenic
1189697707 X:43682238-43682260 CACACCTAGAACCCAGATCTTGG + Intronic
1189844890 X:45126494-45126516 CACACCCATCACCAAGATCTTGG - Intergenic
1190020078 X:46866238-46866260 CACACCTAGCACCCAGATCATGG - Intronic
1190155400 X:47987784-47987806 CACAGCTAGCACCCAGATTTTGG + Intronic
1190160502 X:48028452-48028474 CTGACCTCCCTCCTAGATGTGGG - Intronic
1190450332 X:50572995-50573017 CACACCTAGAACCCAGATATTGG - Intergenic
1190894883 X:54607402-54607424 CACACCTAGGACCCAGATCTTGG + Intergenic
1191086623 X:56574664-56574686 AACACCTAGCACCCAGATTTTGG - Intergenic
1195638521 X:107146931-107146953 CACACCTAGAACCTAGATCTTGG - Intronic
1197016325 X:121631000-121631022 CACACCTATCACCCAGATCTTGG + Intergenic
1198008363 X:132523038-132523060 CACACCTAGCACTCAGATCTTGG + Intergenic
1198055008 X:132985174-132985196 CATTCCTGCCACCTACATGTGGG + Intergenic
1198301430 X:135337624-135337646 CATTCCTGCCACCTACATGTGGG - Intronic
1199226877 X:145386328-145386350 CACACCTACCACCGAGATCTTGG - Intergenic
1199859285 X:151785672-151785694 CACACCTAACACTTAGATCTTGG - Intergenic
1200280692 X:154774667-154774689 CACACCTGCCACCTGGAAGCAGG + Exonic
1201126523 Y:10920080-10920102 CACACTGATCACCTAGATGATGG + Intergenic
1201305031 Y:12542609-12542631 CACGCCTGCCTCCTAGAAGTGGG - Intergenic