ID: 1184579413

View in Genome Browser
Species Human (GRCh38)
Location 22:45404273-45404295
Sequence CTTACTTTCCAACCTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 2, 1: 3, 2: 91, 3: 273, 4: 323}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184579411_1184579413 -8 Left 1184579411 22:45404258-45404280 CCCTATATCATATAGCTTACTTT 0: 1
1: 0
2: 1
3: 37
4: 377
Right 1184579413 22:45404273-45404295 CTTACTTTCCAACCTGATGCTGG 0: 2
1: 3
2: 91
3: 273
4: 323
1184579412_1184579413 -9 Left 1184579412 22:45404259-45404281 CCTATATCATATAGCTTACTTTC 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1184579413 22:45404273-45404295 CTTACTTTCCAACCTGATGCTGG 0: 2
1: 3
2: 91
3: 273
4: 323
1184579408_1184579413 20 Left 1184579408 22:45404230-45404252 CCATGCCTGGCCAGAGGGGTTTT 0: 1
1: 0
2: 17
3: 148
4: 1102
Right 1184579413 22:45404273-45404295 CTTACTTTCCAACCTGATGCTGG 0: 2
1: 3
2: 91
3: 273
4: 323
1184579409_1184579413 15 Left 1184579409 22:45404235-45404257 CCTGGCCAGAGGGGTTTTATTCA 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1184579413 22:45404273-45404295 CTTACTTTCCAACCTGATGCTGG 0: 2
1: 3
2: 91
3: 273
4: 323
1184579410_1184579413 10 Left 1184579410 22:45404240-45404262 CCAGAGGGGTTTTATTCACCCTA 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1184579413 22:45404273-45404295 CTTACTTTCCAACCTGATGCTGG 0: 2
1: 3
2: 91
3: 273
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184579413 Original CRISPR CTTACTTTCCAACCTGATGC TGG Intronic
902007029 1:13240359-13240381 CTTACTTTCCAATCTGACTCTGG - Intergenic
902026080 1:13384638-13384660 CTTACTTTCCAATCTGACTCTGG - Intergenic
904387611 1:30154488-30154510 CTTACTTTCCAATCTGACTCTGG - Intergenic
904394455 1:30209254-30209276 TTTACTTTCCAACCTCACTCTGG + Intergenic
904733737 1:32614237-32614259 CTTACTTTCCAATCTGACTCTGG - Intronic
904736970 1:32642112-32642134 CTTACTTTCTAACCTGAGTCTGG + Intronic
905494472 1:38373824-38373846 CTTACTTTCCACCCTGAGTCTGG - Intergenic
908338302 1:63149868-63149890 ATTTCTTTCCAGCCTGAAGCTGG - Intergenic
910401741 1:86844162-86844184 CTTACTTTCCAGTCTGACTCTGG - Intergenic
911047946 1:93644034-93644056 CTTACTTTCCAATCTGACTCTGG + Intronic
911107712 1:94149583-94149605 CTTACTTGCCAACCTGACTCTGG - Intronic
911167116 1:94734220-94734242 CTTACTTTCCAACCTGACTCTGG + Intergenic
911167119 1:94734243-94734265 CTTACTTTCCAACCTGATTCTGG + Intergenic
911624611 1:100107208-100107230 CTAACTTTCCAAACTGAAACAGG + Intronic
912346482 1:108967870-108967892 CTTACTTTCCAATCTGACTCTGG - Intergenic
912620534 1:111151887-111151909 TTTACTTTCCAACCTGACTCTGG - Intronic
913695417 1:121320128-121320150 CTTATTTTCCAGCCTGAAGTGGG + Intronic
915096862 1:153469170-153469192 CTTACTTTCCATGCTGACTCTGG + Intergenic
915208660 1:154289698-154289720 TTTACTTTCCAACCTGACTCTGG - Intergenic
915377922 1:155414207-155414229 TTTATTTTCCACCCTGCTGCTGG + Intronic
915672494 1:157502129-157502151 CTTACTTTCCAATCTGACTCTGG - Intergenic
915892952 1:159788479-159788501 CTTACTTTCCAATGTGACTCTGG - Intergenic
916226544 1:162495058-162495080 CTTACTTTCCAACCTAACTCTGG - Intergenic
917117819 1:171620308-171620330 CTTACTCTCCAACCTGACTCTGG + Intergenic
917442859 1:175082307-175082329 CTTTCTTTCTAATCTGATTCAGG + Intronic
918853545 1:189722045-189722067 CTTACTTTCCAATCTGACTCTGG + Intergenic
919705046 1:200668535-200668557 CTTACTTTCCAATCTGACTCTGG + Intronic
921990890 1:221365418-221365440 CTTACTTTCCAATCTGACTCTGG - Intergenic
922048942 1:221972108-221972130 TTTACTTTCCAACCTGACTCTGG + Intergenic
922203030 1:223422740-223422762 CTTCCTTTCCTTCCTGATCCAGG - Intergenic
923384371 1:233451974-233451996 CTTACTTTCCAAGCTGATTCTGG + Intergenic
923413570 1:233733274-233733296 AATACTTTCCAACCTGACTCTGG - Intergenic
923442994 1:234039331-234039353 CTATCTTTCCAACCAGATGATGG - Intronic
923459740 1:234197816-234197838 CTCACATTACAACCTGATGCTGG - Intronic
923706740 1:236350265-236350287 CTTACTTTCCAATCTGACCCTGG - Intronic
923956686 1:239030553-239030575 CTTACTTTCCAACCTGACTCTGG - Intergenic
924262595 1:242247395-242247417 CTTACTGTCCAACCTGACTCTGG - Intronic
1062771742 10:106558-106580 CTTACTTTCCAATCTGACCCTGG - Intergenic
1063964305 10:11334719-11334741 CATACATTCCAAACTGCTGCGGG + Exonic
1064542297 10:16417280-16417302 CTTACTTTCCAATCTGGTTCTGG + Intergenic
1064570134 10:16684274-16684296 CTTACTTTCCAATCTGACTCTGG - Intronic
1065414270 10:25467540-25467562 GTTACTTTCCAATCTGACTCTGG - Intronic
1065696496 10:28385426-28385448 CTTACTTTCCAGCCTGACTCTGG - Intergenic
1065745413 10:28836614-28836636 TTTATTTTCCAAAATGATGCTGG + Intergenic
1065847212 10:29755521-29755543 CTTACTTTCCAATCTGACTCTGG + Intergenic
1066143844 10:32535924-32535946 CTTACTATCCAACCTGACTCTGG - Intronic
1066685650 10:37978925-37978947 CTTACTTTCCAACCAGACTCTGG + Intergenic
1068181680 10:53527627-53527649 CTTACTTTCCAAGCTGACTCTGG - Intergenic
1068438505 10:57020724-57020746 CTTACTTTCCAATCTGACTCTGG - Intergenic
1068966961 10:62922230-62922252 CTTACTTTCCAACCTGACTCTGG + Intergenic
1069048352 10:63766214-63766236 CTTACTTTCCAACCTGACTCTGG + Intergenic
1069185713 10:65420117-65420139 CTTATATTCCAATCTGATTCTGG + Intergenic
1069211438 10:65765743-65765765 CTTACTTTCCATCCTACTGCTGG + Intergenic
1069925790 10:71850013-71850035 CTTACTTTCCAATCTGACTCTGG + Intronic
1070573340 10:77658326-77658348 CTTACTTTCCAATCTGACTCTGG - Intergenic
1070958051 10:80477676-80477698 CTTTCCTTCCACCGTGATGCTGG + Intronic
1071551245 10:86567921-86567943 TTTACTTTCCAACCTGACTCTGG - Intergenic
1071674185 10:87639328-87639350 CTTACTTTCCAACCTGACTCTGG - Intergenic
1072450738 10:95537684-95537706 CTCTCATTCCACCCTGATGCTGG + Intronic
1073548628 10:104376178-104376200 CTTACTTTCCAATCTGACTCTGG - Intronic
1073867786 10:107824999-107825021 CTTACATTCCAACCTGCCCCTGG - Intergenic
1073980583 10:109149135-109149157 CTTACTTTCCAATCTGACTCTGG - Intergenic
1074215187 10:111377248-111377270 CTTACTTTCCAATCTGACTCTGG - Intergenic
1076007473 10:126959400-126959422 TTTACTTTCCAACCTGACTCTGG - Intronic
1076045301 10:127288496-127288518 CTTACTTTACATCCTGGTGCAGG - Intronic
1076240001 10:128897716-128897738 CTTCCTTCCCCACCTGATTCTGG + Intergenic
1076408476 10:130229799-130229821 CCTACTTTCCAACCTGACTCTGG - Intergenic
1076553283 10:131302417-131302439 CTTATTTTCCAACCTGACTCTGG + Intronic
1076652565 10:131999808-131999830 CTTACTTTCCAAGCTGACTCTGG + Intergenic
1076652935 10:132002451-132002473 CTTACTTTCCAACCTGACTCTGG + Intergenic
1076653625 10:132006747-132006769 CTTACTTTCCAACCTGACCCTGG - Intergenic
1076997015 11:302692-302714 CTTACTTTCCAACCTGACTCTGG - Intergenic
1076999886 11:317435-317457 CTTACTTTCCAACCTGGCCCTGG - Intergenic
1079529388 11:21431582-21431604 CTTACTTTCCAACCTTATCATGG - Intronic
1079643433 11:22834309-22834331 TTTACTTTCCAACCTAACTCTGG + Intergenic
1079750357 11:24189388-24189410 CTTACTTTTCAAACTGAAGAAGG - Intergenic
1080962614 11:37178174-37178196 CTTACTTTCTAACCTGACTCTGG + Intergenic
1081098973 11:38978210-38978232 CTTACTTTGCAATCTGACTCTGG - Intergenic
1081328662 11:41777733-41777755 CTTACCTTCCAATCTGACTCTGG + Intergenic
1081379663 11:42399234-42399256 CTTACTTTTCAACCTGACTCTGG - Intergenic
1082102561 11:48185119-48185141 CTTACTTTCCAATTTGACTCTGG + Intergenic
1082689579 11:56283307-56283329 CTTACTTTCCAAACTGACTCTGG - Intergenic
1082846186 11:57727572-57727594 CTTACTTTCCTATCTGACTCTGG + Intronic
1083055170 11:59812264-59812286 CTTACTTTTCAACATGACTCTGG - Intergenic
1083353170 11:62045650-62045672 CTTACTTTCCAATCTGACTCTGG - Intergenic
1084801070 11:71544473-71544495 CTTACTTTCCAACCCGACTCTGG + Intronic
1084879141 11:72157681-72157703 CTTACTTTCCAACCTGACTCTGG + Intergenic
1085281179 11:75331834-75331856 CTTACTTTCCAGTCTGACTCTGG + Intronic
1085454544 11:76658352-76658374 CTTCCTTTCCACCCTGGTGTGGG - Exonic
1085495322 11:76963775-76963797 CTTACTTTTCAACCTGACTTTGG - Intronic
1085543862 11:77298862-77298884 TTTTCTTTCCAACCTGACTCTGG - Intronic
1086384712 11:86295368-86295390 CTTACTGGCCATTCTGATGCAGG + Intergenic
1086460190 11:86998384-86998406 CTTGCTTTCCAACCTGAATCTGG - Intergenic
1086511012 11:87558160-87558182 CTTACTTTCCAAGCTGACTCTGG + Intergenic
1086856890 11:91876255-91876277 CTTATTTTCCAATCTGACTCTGG + Intergenic
1086963640 11:93005904-93005926 CTTACTTTCCAATCTGACTCTGG + Intergenic
1088178006 11:107076042-107076064 CTTACTTTTCAATCTGACTCTGG + Intergenic
1088212822 11:107475262-107475284 CTTACTTTCCAATATGACTCTGG + Intergenic
1089721922 11:120433163-120433185 CTAACTTTCCAAACTTATTCAGG + Intronic
1089864180 11:121617373-121617395 CTTACTTTCCAAGTTGACTCTGG - Intronic
1090026289 11:123170232-123170254 CCTGCTTTCCAACCTGACTCGGG - Intronic
1090108016 11:123872751-123872773 CTTACTTTCCAGTCTGACTCTGG + Intergenic
1090917326 11:131177104-131177126 CTAACTCTCCAACTTGAGGCAGG + Intergenic
1090947955 11:131448384-131448406 CCTCCTGTCCAACATGATGCAGG + Intronic
1092336237 12:7636448-7636470 CTTACTTTCCAATCTGACTCTGG - Intergenic
1092613648 12:10196899-10196921 CTTACTTTCCCATCTGACTCTGG + Intergenic
1092629185 12:10360289-10360311 CTTACTTTCCAATCTGACTCTGG - Intergenic
1094018367 12:25887306-25887328 CTTATTTTCCAACATGACTCTGG + Intergenic
1094588867 12:31802321-31802343 CTTACTTTCCAATCTGACTCTGG - Intergenic
1094589602 12:31808134-31808156 CTTACTTTCCAATCTGACTCTGG + Intergenic
1094618336 12:32056521-32056543 TTTACTTTCCAATCTGACTCAGG + Intergenic
1094618621 12:32059053-32059075 CTTACTTTCCAATCTGACTCTGG + Intergenic
1094644792 12:32311927-32311949 GTTACTTTCCAATCTGATACTGG - Intronic
1095314701 12:40745835-40745857 CTTACTTTCCAACCTGACTCTGG - Intronic
1096034133 12:48449410-48449432 CTTACTTTCCAACTTGACTCTGG - Intergenic
1097756240 12:63409429-63409451 CTTACTCTCCAACCTGACTCTGG - Intergenic
1098183480 12:67872414-67872436 TTTGCTTTCCAACCTGACTCTGG - Intergenic
1098316221 12:69196054-69196076 CTTACTTTCCAATCTGACTTGGG - Intergenic
1098710439 12:73751696-73751718 CTTACTTTTCAATGTGATTCTGG - Intergenic
1099094536 12:78356663-78356685 CTTACTTTCCAATCTGGCTCTGG - Intergenic
1099757547 12:86873196-86873218 CTCACTTTCCACCATGTTGCTGG - Intergenic
1099798952 12:87432884-87432906 CTTACTTTCCAATCTGACTCTGG - Intergenic
1099905495 12:88765067-88765089 TTTACATTCCAAGCTGATTCTGG + Intergenic
1100264686 12:92964267-92964289 TTTACTTTCCAACCTGACTCTGG + Intergenic
1100619261 12:96255823-96255845 CTTACTTTTCAATCTGACTCTGG - Intronic
1101176223 12:102154647-102154669 TTTACTTTCCAGCCTGACTCTGG + Intronic
1102355134 12:112227577-112227599 ATCACTTTCCAAACTGATGATGG - Intronic
1103271985 12:119681050-119681072 CAGACTTTTCAACCTGCTGCCGG + Exonic
1104350404 12:128040322-128040344 CTTACTTTCCAACCCAACTCTGG + Intergenic
1105266750 13:18825830-18825852 ATTACTTTCTCACCTGATTCTGG + Intergenic
1106119766 13:26850436-26850458 CTTACTTTCCAATCTGACTCTGG + Intergenic
1106390274 13:29328901-29328923 CTTGCTTTCCAACCTGACTCTGG - Intronic
1107461749 13:40610552-40610574 CTTATTTTCCATCCTGATGGAGG + Intronic
1107530680 13:41279635-41279657 CTTACTTTTCAACCTGACTCTGG + Intergenic
1108046953 13:46392174-46392196 CTTACTTTCCAATCTGACTCTGG + Intronic
1108279920 13:48851092-48851114 CTTACTTTCCAATCTGACTCTGG + Intergenic
1108554887 13:51583199-51583221 CTTACTTTCCAGTCTGACTCTGG - Intergenic
1108883273 13:55147692-55147714 CTTGCTTTTTAACCTGATTCTGG + Intergenic
1108920073 13:55662058-55662080 CTGAGTTTCCAACTTGACGCTGG - Intergenic
1109102959 13:58209626-58209648 CTTACTTTCCAATCTGACTCTGG - Intergenic
1109778774 13:67079491-67079513 CTTACTTTCCAACCTGACTCTGG + Intronic
1110816010 13:79860651-79860673 CTTACTTTCCAATCTGACTCTGG - Intergenic
1111087231 13:83392560-83392582 TTTACTTTCCAACCTGATTCAGG - Intergenic
1111533682 13:89573808-89573830 CTTACTTTCCAATCTGACTCTGG + Intergenic
1112280756 13:98060922-98060944 CCTACTTTCCAATCTGACTCTGG + Intergenic
1112418929 13:99229621-99229643 CTTGCTTTGCAAGGTGATGCAGG + Intronic
1112672511 13:101656457-101656479 CTTACTTTCCACTCTGACTCAGG - Intronic
1112707163 13:102083456-102083478 CTTACTTTCCAACCTGACTCTGG + Intronic
1113161904 13:107391349-107391371 CTTACTTTTCAATCTGACTCTGG + Intronic
1113262928 13:108585706-108585728 CTTACTTTTCAATCTGACTCTGG - Intergenic
1113740475 13:112709266-112709288 CTTACTTTCCAATCTGACTCTGG + Intronic
1114080050 14:19195964-19195986 CTTACTTTCCAACCTGACTCTGG - Intergenic
1114206222 14:20573589-20573611 CTTACTTTCCAATCTGACTCTGG - Intergenic
1114229408 14:20766991-20767013 TTTACTTTCCAACCTGACTCTGG + Intergenic
1114874699 14:26701188-26701210 CTTACTTTCCAACCTGACTCTGG - Intergenic
1114998355 14:28388670-28388692 CTTACTTTCCAACCTGACTCTGG - Intergenic
1116131817 14:40864477-40864499 TTTATTTTCCAACCTGACTCTGG + Intergenic
1116471850 14:45294799-45294821 CTTACTTTCCAACCTGACTTTGG + Intergenic
1117209688 14:53482610-53482632 TTTACTTTCCAACCTGACTCTGG - Intergenic
1117672294 14:58120942-58120964 CTTACTTTCCAACTTGACTCTGG - Intronic
1118553985 14:66992440-66992462 ATTACTTTCTAACTTGATTCAGG - Intronic
1120007359 14:79374544-79374566 CTTACTTTCCAATCTGACTCTGG + Intronic
1120107499 14:80513740-80513762 CTTACTTTCCAATCTGACTCTGG + Intronic
1120771377 14:88384073-88384095 CTTACTTTCCAATCTGATTCTGG - Intergenic
1121731662 14:96191729-96191751 CTTACTTTCCAACCTGACTCTGG + Intergenic
1122062344 14:99144365-99144387 CTTACTTTCCAACCTGACTCTGG + Intergenic
1122119718 14:99545743-99545765 CGTACCTTTCAGCCTGATGCTGG - Intronic
1122653698 14:103242465-103242487 CTTACTTTCCAACCTGACTCTGG + Intergenic
1122832690 14:104408453-104408475 CTTACTTTCCAATCTGACTCTGG - Intergenic
1123127961 14:105963044-105963066 TTTACTTTCCAAACTGACTCTGG + Intergenic
1202831771 14_GL000009v2_random:42263-42285 CTTCCTTTCTAATCTGATTCTGG - Intergenic
1123408477 15:20039187-20039209 TTTACTTTCCAAACTGACTCTGG + Intergenic
1123517801 15:21045828-21045850 TTTACTTTCCAAACTGACTCTGG + Intergenic
1123669682 15:22643277-22643299 CTTACTTTGCAATCTGACTCTGG + Intergenic
1123876482 15:24628645-24628667 CTTACTTTCCAACCTGACTGTGG + Intergenic
1123986916 15:25654300-25654322 CTTACTTTCCATCCTGACCCTGG - Intergenic
1124033250 15:26030493-26030515 CTTACTTTCCAATGTGACTCTGG - Intergenic
1124033303 15:26030938-26030960 CTTACTTTCCAATGTGACTCTGG - Intergenic
1124525656 15:30449720-30449742 CTTACTTTGCAATCTGACTCTGG + Intergenic
1124603827 15:31155859-31155881 CTTACTTTCCAACCTGACTATGG + Intronic
1124772999 15:32557965-32557987 CTTACTTTGCAATCTGACTCTGG - Intergenic
1126645058 15:50867605-50867627 CTTACTTTTCAATCTGACTCTGG - Intergenic
1127507221 15:59609098-59609120 TTTACTTTCCAACCTGACTCTGG + Intronic
1129195495 15:73963111-73963133 CTTACTTTTCAATCTGACTCTGG + Intergenic
1130003873 15:80075064-80075086 CTGACTTTCAGAGCTGATGCTGG + Intronic
1131636431 15:94237553-94237575 CTTACTTTCCAATCTGACTCTGG + Intronic
1131871667 15:96770330-96770352 CTTACTTTCCAATTTGACTCTGG + Intergenic
1132417922 15:101637512-101637534 CTTACTTTCCAACCTGACTCTGG - Intronic
1133408359 16:5545670-5545692 CTTACATTCCTACTTGATGAGGG - Intergenic
1133800143 16:9078692-9078714 CTTACTTTTCAGCCTGACTCTGG - Intergenic
1134002063 16:10790634-10790656 CTTACTTTCCAATCTGATTCTGG - Intronic
1134397076 16:13874887-13874909 CTTACTTTCCAACCTGACCCTGG + Intergenic
1135225131 16:20649298-20649320 CTTACTTTCCAATCTGACTCTGG + Intronic
1135229538 16:20692753-20692775 CTTACTTTCCAATCAGACTCTGG - Intronic
1135776278 16:25259443-25259465 CTTACTTTCCATTCTGACTCTGG - Intergenic
1137884440 16:52087483-52087505 TTTACTTTCCAATCTGACTCTGG + Intergenic
1138995347 16:62445165-62445187 CTTACTTTCCAAGGTGACTCTGG + Intergenic
1139013680 16:62664130-62664152 CTTACTTTTCAAGCTGACTCTGG + Intergenic
1139633091 16:68242463-68242485 CTTACTTTGCAATCTGACTCTGG - Intergenic
1140054352 16:71512570-71512592 CTTACTTTCCAATCTGACTGTGG - Intronic
1140577425 16:76187199-76187221 CTTCCTTGCCATCCAGATGCTGG - Intergenic
1141371925 16:83495691-83495713 CTTACTTTCCAGCCTGACTCTGG - Intronic
1144118013 17:12119887-12119909 CTTACTTAGCAAACTAATGCAGG + Intronic
1145024670 17:19459020-19459042 CTTACTTTCCAATCTGACTCTGG + Intergenic
1145223559 17:21108655-21108677 CTTACTTTCCAACCTGACTCCGG + Intergenic
1146133657 17:30299139-30299161 CATACTTTCAAACCTGGTGGTGG + Intergenic
1146238671 17:31192787-31192809 CTTACTTTTCAATCTGACTCTGG - Intronic
1146894472 17:36531663-36531685 CTTACCTTCAAACCTGTTCCAGG + Intronic
1146907956 17:36629926-36629948 CTTCCTTTCCTACCAGCTGCAGG - Intergenic
1149136065 17:53366108-53366130 CTTACTTTTCAATCTGACTCTGG + Intergenic
1150909269 17:69371229-69371251 TTTACTTTCCAAACTGACTCTGG - Intergenic
1150956054 17:69861928-69861950 CTTATTTTCCAACCTGACTCTGG + Intergenic
1151132841 17:71916063-71916085 CCTACTTTCCAATCTGACTCTGG + Intergenic
1151908738 17:77067131-77067153 TTTACTTTCCAACCTGACTCTGG + Intergenic
1152045997 17:77936147-77936169 CTTACTTTCCAATCTGACTGTGG - Intergenic
1152048242 17:77953119-77953141 CTCACCTTGCAACCTGCTGCCGG + Intergenic
1152415131 17:80154915-80154937 CTTCCTTTCCAAACTGGTTCTGG - Intergenic
1153130060 18:1845230-1845252 CTTACTTTCCAATCTGACTGTGG + Intergenic
1153136024 18:1918488-1918510 CTTACTTTCCAACCTGATTCTGG + Intergenic
1153138311 18:1942677-1942699 CTTACTTTTCAACCTGACTCTGG - Intergenic
1153157116 18:2162309-2162331 CTTACTTTCCAACCTAACTCTGG + Intergenic
1153271565 18:3327421-3327443 CTTACTGTCCTTCCTGATTCTGG - Intergenic
1153415791 18:4844521-4844543 CTTACTTTCCAATCTGAATCTGG + Intergenic
1153788024 18:8552259-8552281 CTTATTTTCCAACCTGACTCTGG + Intergenic
1154130282 18:11730858-11730880 CTTACTTTCCAATTTGACTCTGG - Intronic
1154312761 18:13280426-13280448 GTTATTTTCCACCCTAATGCTGG + Intronic
1154375566 18:13806607-13806629 CTTACTTTCCAATCTGACTCTGG - Intergenic
1154421659 18:14235636-14235658 CTTCCTTTCTCACCTGATTCTGG - Intergenic
1155787364 18:29917372-29917394 CTTACTTTTCAACCTGACCCTGG + Intergenic
1155954567 18:31946258-31946280 CTTACTTTCCAACTTGACTCTGG + Intronic
1156301514 18:35840532-35840554 CTTACTTTCCAACCTGATGCTGG - Intergenic
1156311216 18:35923857-35923879 CTTACTTTCCAATTTGACTCTGG - Intergenic
1156585712 18:38428765-38428787 CTTACTTTCCAGTCTGACTCTGG - Intergenic
1156684931 18:39633075-39633097 CTTACATTCCAACATGATGAAGG + Intergenic
1157909796 18:51605045-51605067 CTTTCTTTCCACCCTGAATCTGG - Intergenic
1158170923 18:54598624-54598646 CTTACTTTCTAATCTGACTCTGG + Exonic
1158664077 18:59416670-59416692 CTTACTTTCCAATCTGATGCTGG - Intergenic
1158821365 18:61162932-61162954 CTCACTTTCCAACCTGACCCCGG + Intergenic
1158871495 18:61692667-61692689 CTTATTTTCCAACCTGATTCTGG - Intergenic
1158894193 18:61897995-61898017 TTTACTTTCCAACCTGACTCTGG - Intergenic
1159142447 18:64413948-64413970 TTTACTTTCCAACCTTACTCTGG - Intergenic
1159594204 18:70367215-70367237 TTTACTTTCCAATCTGACTCTGG + Intergenic
1159604337 18:70459379-70459401 CTTACCTTCCCACCTGTTGATGG - Intergenic
1159653546 18:71005109-71005131 CTTACTTTCCAACCTGGCTCTGG - Intergenic
1159832413 18:73293581-73293603 CTGGCTTTCCATCCTGATGATGG + Intergenic
1160537229 18:79601100-79601122 CTTACTTTCCAGTCTGACTCTGG + Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1164127512 19:22331878-22331900 TTGACTTTCCCACCTGAAGCTGG - Intergenic
1164430743 19:28186504-28186526 CTTATTTTCCACCCAGATACAGG - Intergenic
1165368954 19:35390398-35390420 CTTACTTTCCAATCTTACTCTGG - Intergenic
1166418259 19:42611871-42611893 CTTACTTTCCAGTCTGACTCTGG + Intronic
1167943239 19:52964309-52964331 CTTACTTTCCAGTCTGACTCTGG - Intergenic
1168084511 19:54035560-54035582 CTTACTTTCCAATCTGACTCTGG - Intergenic
1168143472 19:54405169-54405191 CTTACTTTCCAATCTGACTCTGG - Intergenic
925229542 2:2220725-2220747 CTTGCTTTCCAAACTGACTCTGG - Intronic
925869166 2:8254196-8254218 CTTACTTTCCAACGTGACTCTGG + Intergenic
927333465 2:21892897-21892919 CTCACTTTCTACCCTGAGGCAGG + Intergenic
927341658 2:21990373-21990395 CTTGCTCTCCAACCTCATGCTGG + Intergenic
927718890 2:25370468-25370490 CTTACTTTCCAGCCTGACTCTGG + Intergenic
927892731 2:26762534-26762556 CTTACTTTCCAATCTGACTCTGG + Intergenic
927950604 2:27165981-27166003 CTTACTTTCCAACCTGACTGTGG + Intergenic
928296952 2:30091880-30091902 CTTACTTTCAAACCTGATTCTGG + Intergenic
928698835 2:33878285-33878307 CTTAATTTCCACTCTGATTCTGG + Intergenic
928716170 2:34063340-34063362 CTTACTTTCCAACCCGACTCTGG - Intergenic
928926472 2:36584879-36584901 CTGACTTTCCAACATTAGGCTGG + Intronic
930366105 2:50441524-50441546 CTAACTTTCCCACCTACTGCTGG - Intronic
930499355 2:52192641-52192663 CTTACTTTTCAATCTGACTCTGG + Intergenic
931418175 2:62100976-62100998 CTTACTTTCCAATCAGACTCTGG - Intronic
932058642 2:68472392-68472414 CTTACTTTCCAGTCTGACTCAGG - Intronic
932245436 2:70192652-70192674 CTTACTTTCCAGCCTGAATCAGG + Intronic
932666972 2:73705826-73705848 CTGACTTTCCTACCTGACTCTGG - Intergenic
932668903 2:73719830-73719852 CTGACTTTCCTACCTGACTCTGG - Intergenic
932690409 2:73908278-73908300 CCTACTTTCCAGCCTCTTGCAGG + Intronic
933066687 2:77807137-77807159 CTTACTTTCCAATCTGTCTCTGG + Intergenic
933225493 2:79744038-79744060 CTTCCTTGCCACCCTGAGGCTGG + Intronic
933309685 2:80644879-80644901 TTGCCTTTCAAACCTGATGCAGG - Intronic
933427194 2:82128222-82128244 CTTACTTTCCAACCTGACTCTGG + Intergenic
933514441 2:83283123-83283145 CTTACTTTCCAACCTGACTCTGG + Intergenic
934155676 2:89197810-89197832 CTTACTTTCCAACCTGACTGTGG + Intergenic
934211649 2:89984949-89984971 CTTACTTTCCAACCTGACTGTGG - Intergenic
934496482 2:94805488-94805510 CTTCCTTTCTAACCTGATTCTGG + Intergenic
934687454 2:96332258-96332280 CTGACTTTCCAGCCTGCAGCTGG - Intergenic
935181635 2:100696040-100696062 CTTACTTTCCAACCTGACTGTGG - Intergenic
935250712 2:101257825-101257847 TTTTCTTTCCCAGCTGATGCTGG + Exonic
935612135 2:105036853-105036875 CTTACTTTCCAACCTGACTCTGG - Intergenic
935871288 2:107452675-107452697 CTTAAATTCCATCCAGATGCAGG - Intergenic
935872601 2:107467815-107467837 CTTATTTTCCAACATGATGGAGG - Intergenic
935889697 2:107662829-107662851 CTTACTTTCCAGTCTGACTCTGG - Intergenic
936677666 2:114734054-114734076 CTTACTTTCCAATCTGACCCTGG + Intronic
936706881 2:115085973-115085995 CTTACTTTCCAATCTGACTCTGG + Intronic
936787747 2:116114673-116114695 CTTACTTTTCAATCTGACTCTGG - Intergenic
936871272 2:117136255-117136277 TATACTTTCCAACCTGACTCTGG - Intergenic
937523268 2:122736876-122736898 CTTACTTTCCAACCTGACTCTGG + Intergenic
937644314 2:124249180-124249202 CTTACTTTCCAATCTGACTCTGG + Intronic
938964966 2:136380398-136380420 CTTACCTTCCCACCCGATGCAGG - Intergenic
939250259 2:139673377-139673399 CTTACTTTTCAATCTGACTCTGG + Intergenic
939496078 2:142930102-142930124 CTTACTTTCCAACCTTACTCTGG - Intronic
940564469 2:155343302-155343324 CCTGCTTTCCAACCTGACTCTGG + Intergenic
942097853 2:172550264-172550286 CTTACTTTTCACCCTGACTCTGG - Intergenic
943212698 2:184988578-184988600 CCTACTTTCCAACCTGAATTTGG + Intergenic
945743204 2:213688534-213688556 CTTACTTTCCAATCTGACTCTGG - Intronic
946327800 2:218993659-218993681 CTTTCTTTCCAGCCTGAGCCAGG + Intergenic
946844557 2:223847871-223847893 GTTACTTTGCAACCTGACTCTGG - Intergenic
946944045 2:224801360-224801382 CTTACTTTCCAACCTGACTCTGG - Intronic
947020300 2:225666970-225666992 CTTACTTTCCAATCTGACCCTGG - Intergenic
947172124 2:227322426-227322448 CTTACTTTCCAATCTGACTCTGG - Intergenic
947172282 2:227323830-227323852 CTTACTTTCCAATCTGACACTGG + Intergenic
947427026 2:229993074-229993096 TTTACTTTCCAACCTGACTCTGG + Intronic
948016329 2:234693668-234693690 CTTACTTTCCAACCTGACTCTGG + Intergenic
948020130 2:234725282-234725304 CTTACTTTCCAATCTGACTCTGG - Intergenic
949030034 2:241790603-241790625 TTTACTTTCCAATCTGAGTCTGG + Intronic
1168747283 20:254297-254319 CTTACTTTTCAATCTGACTCTGG - Intergenic
1168823142 20:790590-790612 CTTGCTTTCCAATCTGACTCTGG - Intergenic
1168843806 20:928134-928156 CTTACTTTCCGACCTGACCCTGG - Intergenic
1169269273 20:4186993-4187015 CTTACTTGTCAACTTGAGGCAGG - Intronic
1169324240 20:4662304-4662326 CTTACTTTCCAACCTGACTCTGG - Intergenic
1169456006 20:5753154-5753176 CTTATCTTCCAACCTGACACTGG - Intronic
1170129176 20:13000449-13000471 CTTGCCTTCCCACATGATGCAGG + Intergenic
1170500002 20:16965426-16965448 CTTACTTTTCAACCTGACTCTGG + Intergenic
1170659503 20:18323136-18323158 CTTATTTTCCAACCTGACTCTGG - Intergenic
1171238042 20:23543949-23543971 CTTGTTTTCCAACCTGACTCTGG - Intergenic
1171512131 20:25694746-25694768 CTCACTTTCCAACCTGACTCTGG + Intronic
1171887792 20:30672220-30672242 CTTCCTTTCTAACTTGATTCTGG + Intergenic
1173022443 20:39278337-39278359 CTTACTCTGCAAACTGCTGCAGG - Intergenic
1174120275 20:48259742-48259764 CTTACGTTTCAATCTGGTGCAGG - Intergenic
1174956263 20:55102219-55102241 CTTACTTTCCAATCTGACTCTGG - Intergenic
1175058000 20:56215728-56215750 CTTACTTTCCAATCTGACCCTGG + Intergenic
1175181360 20:57149998-57150020 CTCACTTTCCAACCTGACGCTGG - Intergenic
1175890333 20:62313166-62313188 CTGACTGTCGAAGCTGATGCGGG + Exonic
1176361365 21:5999487-5999509 CTTACTTTTCAATCTGACTCTGG - Intergenic
1176362284 21:6007845-6007867 ATGACTTTCCAACCTGACTCTGG - Intergenic
1176851816 21:13924320-13924342 CTTACTTTCTCACCTGATTCTGG + Intergenic
1177156454 21:17506118-17506140 CTTACTTTCCAACCTGACTCTGG + Intergenic
1177176008 21:17701503-17701525 CTTACTTTCCAACCTGACTCTGG - Intergenic
1177435533 21:21047914-21047936 CTTAATTTCCAATCTGACTCTGG + Intronic
1178031738 21:28535435-28535457 CTTACTTTTCAATCTGACTCTGG - Intergenic
1178386948 21:32160127-32160149 CTTACTTTCCAATCTGACTCTGG - Intergenic
1178863307 21:36307242-36307264 CTTACTTTCCAATCTGATTCTGG - Intergenic
1179448897 21:41454238-41454260 CTTACTTTCCAACCCGACTCTGG - Intronic
1179460600 21:41532304-41532326 CTGACTTTCCAATCTGACTCTGG - Intergenic
1179649621 21:42799147-42799169 CTGACTTTCCAATCTGACTCTGG - Intergenic
1179761234 21:43530700-43530722 ATGACTTTCCAACCTGACTCTGG + Intronic
1179762153 21:43539063-43539085 CTTACTTTTCAATCTGACTCTGG + Intronic
1179892525 21:44343967-44343989 CTTACTTTCCAATCTGACTCTGG - Intergenic
1179915029 21:44471348-44471370 CTTACTTTCCAGTCTGACTCTGG + Intergenic
1180361031 22:11896373-11896395 CTTCCTTTCTAATCTGATTCTGG - Intergenic
1180500721 22:15926736-15926758 CTTACTTTCCAACCTGACTCTGG + Intergenic
1180578445 22:16804333-16804355 CTTACTTTCCAGTCTGACTCTGG + Intronic
1182521407 22:30886661-30886683 CTTACTTTCCAACCTGACTCTGG - Intronic
1182801114 22:33032679-33032701 CTTACTTTCCAACCTGACTCTGG + Intronic
1183631740 22:39037479-39037501 GTTACTTTCCAATCTGACTCAGG - Intergenic
1183644102 22:39112672-39112694 CTCACTTTCCAACCTGACTCTGG - Intergenic
1184182995 22:42843604-42843626 CTTATTTTCCAACCAGAAGTGGG + Intronic
1184316747 22:43699232-43699254 CTCACCTTCCAACCTTCTGCTGG - Intronic
1184579413 22:45404273-45404295 CTTACTTTCCAACCTGATGCTGG + Intronic
1184848526 22:47103879-47103901 CTTACTTTCCAGCCTGACTTTGG + Intronic
949439944 3:4069752-4069774 CTTACTTTTCAATCTGACTCTGG + Intronic
949963870 3:9338492-9338514 CTTAGTTTCCATCCCAATGCTGG - Intronic
950830766 3:15873529-15873551 CTGACTTTACATTCTGATGCTGG - Intergenic
950999058 3:17537199-17537221 CTTACTTTCCAAGCTGACTCTGG - Intronic
951300150 3:20986675-20986697 CTTACTTTCCAATCTGACTCTGG - Intergenic
951300956 3:20995475-20995497 CTTACTTTCCAGTCTGACTCTGG - Intergenic
952454808 3:33463069-33463091 CTTGCTTTCCAACCTGACTCTGG + Intergenic
952581372 3:34837447-34837469 CTTACTTTCTAACCTGTCTCTGG + Intergenic
953427420 3:42806312-42806334 CTTACTTTCCAACTTGACTCTGG - Intronic
953855459 3:46496399-46496421 GCTACTTTCCAACCTGACTCTGG - Intergenic
954119815 3:48490660-48490682 TTTACTTTCCAACCTGACTCTGG + Intronic
955613033 3:60777734-60777756 CTTACTTTCCAATCTGACTGTGG - Intronic
956708674 3:72021478-72021500 CTTACTTTCCAATCTGACTCTGG + Intergenic
957600166 3:82323800-82323822 CTTACTTTCCAATCTGACTCTGG + Intergenic
957632798 3:82739687-82739709 TTTTCTTTCCAACCTGACTCCGG + Intergenic
957649606 3:82982704-82982726 CTTCCTTAGCAACCTAATGCAGG + Intergenic
958077335 3:88698044-88698066 TTTACTTTGCAACCTGTTTCAGG - Intergenic
958566399 3:95816763-95816785 CTTATTTTCCAACCTGACTCTGG + Intergenic
959062670 3:101630158-101630180 TTTACTTTCCAACCTGACTCTGG + Intergenic
959296776 3:104545411-104545433 CTTACTTTCCAATTTGACTCTGG + Intergenic
961344123 3:126250644-126250666 CTTACTTTCCAACCCGACTCTGG + Intergenic
961566887 3:127770404-127770426 CATTCTTTCCCACCTTATGCAGG - Intronic
961835237 3:129652634-129652656 CTTTCTTTCCAACCTGACTCAGG + Intronic
961839359 3:129695922-129695944 CTTACTTTCCAATCTGACTCTGG + Intronic
962074880 3:132071055-132071077 CTTACTTTCCAACATTAAGAGGG - Intronic
963412800 3:144953240-144953262 CATACTTTTCAACCTGACTCTGG - Intergenic
963433168 3:145235368-145235390 CTTACTTTCCAACTTGACTCTGG + Intergenic
963669361 3:148232240-148232262 TTTACTTTCCAGCCTGACTCTGG - Intergenic
964394475 3:156231329-156231351 CTTACTTTCCAATCTGACTCTGG + Intronic
964458830 3:156898259-156898281 CTTATTTTCCAACCTGACTCTGG - Intronic
964612767 3:158631629-158631651 CTTATTTTCTAACCTGACCCTGG - Intergenic
964734635 3:159903871-159903893 CTTACTTCCCAAGCTGATCTGGG + Intergenic
964845549 3:161040802-161040824 CTTATTTTCCAACCTGACTCTGG + Intronic
964999480 3:162935030-162935052 CTTATTTTCCAACCTGACTCTGG + Intergenic
965180386 3:165395203-165395225 CTTACTTTCCAACCTGACTCTGG + Intergenic
965199595 3:165640145-165640167 ATTACTTTCCAAACTTATTCAGG + Intergenic
966537615 3:181051993-181052015 CTTACTTTTCAATCTGACTCTGG - Intergenic
967195589 3:187022813-187022835 CTTACTCTCCAACCTGACTCTGG - Intronic
967212652 3:187182132-187182154 TTTGCTTTCCAACCTGACTCTGG + Intergenic
967755374 3:193162609-193162631 CTTACTTTCCAATCTGACTCTGG + Intergenic
1202737641 3_GL000221v1_random:21899-21921 CTTCCTTTCTAATCTGATTCTGG - Intergenic
969653326 4:8480828-8480850 CTTACTTTCCAACCTGACCCTGG + Intronic
970082219 4:12300356-12300378 CTTACTTTCCAAACTGACTCTGG - Intergenic
970711607 4:18870255-18870277 CTTACTTGCCAACCTGACTCTGG + Intergenic
970942960 4:21656874-21656896 GTTCCTTTCCAACCTGAGCCTGG - Intronic
971250916 4:24972708-24972730 CTGACTTTCCAATCTGACCCTGG + Intronic
971481875 4:27122274-27122296 CTTACTTTCCAACCTGACTCTGG + Intergenic
971713541 4:30147888-30147910 CTTGCTTTCCAATCTGACTCTGG + Intergenic
972034564 4:34505081-34505103 CTTACTTTCCAATCTGACTCTGG - Intergenic
972055966 4:34804258-34804280 CTGACTTTCCAACCTAATTTAGG + Intergenic
972535440 4:39996180-39996202 CTGACTTTCCAACCTGACTCTGG + Intergenic
972566246 4:40271873-40271895 CTTACTTTCCAACCTGACTCTGG + Intergenic
973384437 4:49496019-49496041 CTTCCTTTCTAATCTGATTCTGG + Intergenic
974459116 4:62164803-62164825 GTAACTTTCCAACCTGACTCTGG + Intergenic
974460142 4:62176581-62176603 CTTATTTTCCAATCTGACTCTGG - Intergenic
974615021 4:64269478-64269500 CTTGCTTTCTAACCTGACTCTGG - Intergenic
974627099 4:64439980-64440002 CTTACTTTTCAATCTGAGTCTGG - Intergenic
975250900 4:72176618-72176640 CTTACTTTTCAATCTGACTCTGG + Intergenic
975947733 4:79728024-79728046 CTTACTTTCCAATCTGACTCTGG + Intergenic
976127089 4:81845196-81845218 CTCACTTTCCAACCTGACTCTGG + Intronic
976162184 4:82214206-82214228 CTCACTTTCCAAGCTGCTGAGGG - Intergenic
976162516 4:82218663-82218685 GTTTCTTTCCATCATGATGCAGG + Intergenic
976442095 4:85087587-85087609 CTCACTTTCCAAACTGACTCTGG - Intergenic
976970814 4:91100071-91100093 CTTACTTTCCAACCTGACTCTGG - Intronic
977525486 4:98141164-98141186 CTTACTTTCCAATCTGACTCTGG + Intronic
977985189 4:103374765-103374787 CTTACTTTCCAAACTGACTCTGG + Intergenic
978337381 4:107684323-107684345 CTTCTTTTCCAACCTGACTCTGG + Intronic
978894570 4:113871567-113871589 CTTGCTTTCCAACCTGACTCTGG - Intergenic
981314530 4:143328780-143328802 CTTACTTTTCAATCTGACTCTGG - Intergenic
982085552 4:151832434-151832456 CTTTTTTTCCATCCTGCTGCTGG - Intergenic
983043841 4:162961158-162961180 CTTACTTTCCCACATAATGTTGG - Intergenic
983273504 4:165590740-165590762 CTTACTTTCTAACCTGACTGTGG - Intergenic
983626001 4:169802685-169802707 CTTACTTTCCAATCAGACTCTGG - Intergenic
984364551 4:178781600-178781622 CTTACTTTCCAATCTGACTCTGG - Intergenic
984376035 4:178931214-178931236 CTTACTTTCCAGGCTGACTCTGG + Intergenic
984438059 4:179728735-179728757 CTTACTTTCCAATCTGACTCTGG - Intergenic
984719606 4:182957489-182957511 CTTACTTTCCAACCTAATTCTGG - Intergenic
984983372 4:185303910-185303932 CTTACTTTTCAACCTGAGGCTGG - Intronic
1202768286 4_GL000008v2_random:171343-171365 CTTCCTTTCTAATCTGATTCTGG + Intergenic
986893100 5:12332851-12332873 CTTACTTTCCAATCTGATTCTGG - Intergenic
987744542 5:21952859-21952881 CTTGCTTTCCAACCTGACTCTGG + Intronic
987786588 5:22508330-22508352 CTTACTTTGCAACCTGACTCAGG + Intronic
988017298 5:25575477-25575499 CTTACTTTTCAATCTGACTCTGG + Intergenic
988102184 5:26694516-26694538 CTTACTTTTTAACCTGACGCAGG - Intergenic
988568085 5:32336626-32336648 CTTACTTTCCAACCTGACTCTGG - Intergenic
988629952 5:32918144-32918166 CTTACTTAGCAAACTAATGCAGG - Intergenic
988633055 5:32951785-32951807 CTTACTTTCCTACCTGACTCTGG + Intergenic
988770544 5:34428430-34428452 CTTACTTTCCAAACTGACTCTGG + Intergenic
988801616 5:34701202-34701224 CTTATTTTCCAACCTGACTCTGG + Intronic
988831247 5:34989366-34989388 CCTGCTTTCCAACCTGACTCTGG + Intergenic
990184482 5:53199117-53199139 CTTACTTTCCAGTCTGACTCTGG - Intergenic
990307630 5:54508558-54508580 CTTACTTTCCAAACTGACTCTGG - Intergenic
990741064 5:58913376-58913398 CTTACTTTCCAACCTGACTCTGG + Intergenic
991234566 5:64378848-64378870 CTTGCTTTCCAATCTGACTCTGG + Intergenic
991424610 5:66478027-66478049 CTTACTTTCCAATCTGACTTTGG + Intergenic
991764748 5:69962981-69963003 CTTGCTTTCCAACCTGACTCTGG + Intergenic
991782576 5:70155172-70155194 CTTGCTTTCCAACCTGACTCTGG - Intergenic
991843980 5:70838052-70838074 CTTGCTTTCCAACCTGACTCTGG + Intergenic
991875019 5:71155485-71155507 CTTGCTTTCCAACCTGACTCTGG - Intergenic
993248376 5:85482485-85482507 CTTTCTTTTCATCCTAATGCTGG - Intergenic
994641202 5:102411709-102411731 CTTACTTTCTAATCTGACTCTGG + Intronic
995128853 5:108608745-108608767 CTTACTTTCCAACCTGACTCTGG + Intergenic
995741257 5:115358204-115358226 CTTACTTTCCAACCTGACTCTGG + Intergenic
995823268 5:116263342-116263364 CTTACTTTTCAATCTGACTCTGG + Intronic
995884273 5:116876231-116876253 CTTATTCTCCCATCTGATGCTGG - Intergenic
996123933 5:119704305-119704327 TTTACTTTCCAACCTGATTCTGG + Intergenic
996322040 5:122229541-122229563 CTTACTTTCCAGCCTGACTCTGG + Intergenic
996356972 5:122605904-122605926 CTTTCTTACAAACCTGATGTGGG - Intergenic
996380714 5:122860223-122860245 TTTACTTTCCAACCTGACTCTGG - Intronic
998066675 5:139164890-139164912 CTTACTTTCCAATCTGACTCTGG + Intronic
998252368 5:140561752-140561774 CTGACTTTCCAGCCTCCTGCAGG - Intronic
998727188 5:145031160-145031182 CTTACTTTCCAATCTGACTCTGG + Intergenic
999477067 5:151910202-151910224 CTTTCTTTCCTACCTGGTACAGG + Intronic
999503241 5:152167808-152167830 CTTACTCTCCAACCTGACTCTGG + Intergenic
999558745 5:152775293-152775315 CTTACTTTCCAATTTGACTCTGG - Intergenic
1000147866 5:158470924-158470946 CTCACTGTCCTACCTGATGCGGG - Intergenic
1002851147 6:997465-997487 CTTTCTTTCCTACCTGCAGCAGG + Intergenic
1003195103 6:3907358-3907380 CTTACTTTCCAATCTGACTCTGG + Intergenic
1003202299 6:3973143-3973165 CTTACTTTCCAACCTGACTCTGG + Intergenic
1003231810 6:4260725-4260747 CTTACTTTCCAATCTGACTCTGG + Intergenic
1003475429 6:6477804-6477826 CTTATTTTCCAACCTGACTCTGG + Intergenic
1004604973 6:17185473-17185495 CTTACTTTCCAACCTGACTCTGG - Intergenic
1004955751 6:20725943-20725965 CTTACTTTTCAACCTGACTCTGG + Intronic
1005054696 6:21718612-21718634 CTTACTTTCCAACCTGACTCTGG - Intergenic
1005285495 6:24322335-24322357 CTTACTTTCCAATCTGATTCTGG + Intronic
1005652774 6:27899801-27899823 CTTACTTTCCAACCTGACTCTGG + Intergenic
1007012813 6:38434051-38434073 CTTACTTTCCATTCTGACTCTGG + Intronic
1007311402 6:40949007-40949029 CTTACTTTCCAGTCTGACTCTGG + Intergenic
1008133911 6:47751099-47751121 CTTACTTTCCAATCTGACTCTGG - Intergenic
1008218768 6:48828259-48828281 CTTACTTTCCAACCTGACTCTGG - Intergenic
1008663570 6:53694318-53694340 CTTGCTCTCCAACCTAATCCTGG - Intergenic
1009357199 6:62765268-62765290 CTTACTTTCCAATCTGACTCTGG - Intergenic
1009908119 6:69893571-69893593 CTTACTTTCCAATCTGACTGTGG + Intronic
1010452754 6:76020835-76020857 CTTACTTTCCAATCTGACTCTGG + Intronic
1011121350 6:83956784-83956806 CTTACTTTCCAACCTGACTCTGG - Intronic
1011363143 6:86549859-86549881 CTTACTTTCCAACCTGACTGTGG + Intergenic
1011913598 6:92472992-92473014 CTTCCTTTCCCACCTAAAGCGGG + Intergenic
1012249217 6:96961175-96961197 CTGACTTTCCAACCTGACTCTGG - Intronic
1012634073 6:101513606-101513628 TTTACTTTCCAACCTGACTCTGG - Intronic
1013211200 6:107988489-107988511 CTCACTTTCCAACTTGACTCTGG + Intergenic
1013226716 6:108124245-108124267 CTTTCACTCCAACCTGATGTAGG + Intronic
1013412736 6:109896320-109896342 CTTACTTTCCATCCTGACTCTGG - Intergenic
1014442902 6:121493784-121493806 CTTACCTTCCAATCTGACTCTGG + Intergenic
1014541626 6:122682999-122683021 CTTACTTTGTAACCTGTTTCAGG + Intronic
1014931087 6:127337088-127337110 CTTACTTTTCAATCTGACTCTGG + Intronic
1016159454 6:140859724-140859746 CTTACTTTTCAATCTGACTCTGG + Intergenic
1017349193 6:153419562-153419584 CTTACTTTCCAATCTGACTCTGG - Intergenic
1017863503 6:158421797-158421819 TTTACTTTCCAACCTCACTCTGG - Intronic
1018075463 6:160208431-160208453 CTTACTTTCCAACCTGACTTTGG + Intronic
1018136851 6:160787447-160787469 CTTACTTTCCAATCTGACTCTGG + Intergenic
1018154865 6:160976456-160976478 CTTACTTTCCAATCTGACTCCGG - Intergenic
1018189927 6:161301685-161301707 CTTACTTTCCAAAGTGACTCTGG + Intergenic
1018835833 6:167483209-167483231 CTTACTTTCCAAACTGACTCTGG - Intergenic
1018992158 6:168682322-168682344 CTTATTTTCCAACCTGACTCTGG + Intergenic
1019062962 6:169270039-169270061 TTTACTTTCCAACCTGACTCTGG + Intergenic
1019099763 6:169620015-169620037 CTTATTTTCCAACCTGGCTCTGG - Intronic
1019107008 6:169676362-169676384 CTTACTTTCCAACCTAACTCTGG + Intronic
1019107307 6:169678714-169678736 CTGACTTTCCAATCTGACTCTGG + Intronic
1019932983 7:4235901-4235923 CTTCCTTTCCTACCAGGTGCTGG + Intronic
1020794807 7:12666473-12666495 TTTACTTTCCAGCCTGACTCTGG - Intergenic
1020958363 7:14771646-14771668 CTTACTTTCCAGTCTGATTCTGG + Intronic
1020985312 7:15126649-15126671 CTTACTTTTCAATCTGACTCTGG + Intergenic
1021387604 7:20051035-20051057 CTTACTTTTCAATCTGACTCTGG + Intergenic
1021673544 7:23057658-23057680 CTTACTTTCCAGTCTGACTCTGG + Intergenic
1022034912 7:26525022-26525044 TTTACTTTCCAAGCTGAGTCAGG - Intergenic
1022764995 7:33401945-33401967 CTTACTTTCCAACCTGACTCTGG - Intronic
1022791775 7:33696321-33696343 CTCACTTTCCACCATGCTGCCGG + Intergenic
1023062111 7:36338061-36338083 CTTACTTTCCAACCTGACTCTGG + Intronic
1023090122 7:36609469-36609491 CTCACTGTCCCACCTGGTGCTGG + Intronic
1023338790 7:39197288-39197310 CTTCCTGTCCAACCCGATCCAGG + Intronic
1023667601 7:42541093-42541115 CTTACTTTCCAATCTGACTCTGG - Intergenic
1023742130 7:43290295-43290317 CTTACTTTCCAAACTGACTGTGG - Intronic
1024035161 7:45501703-45501725 CTTTCTCTCCAAGCTGATTCTGG + Intergenic
1024322349 7:48083916-48083938 CTTACTTTCCAACCTGACTCTGG + Intergenic
1024446651 7:49487726-49487748 CTTACTTTCCACCCTGACTCAGG - Intergenic
1024821172 7:53331438-53331460 CTGACTTTCCATCTTAATGCTGG - Intergenic
1025005306 7:55349554-55349576 CTTACTTTTCAATCTGACTCTGG + Intergenic
1025802746 7:64802555-64802577 CTTACTTTCCAATCTGACTCTGG - Intronic
1026143099 7:67722869-67722891 CTTTCTTTCCAACCTGACCCTGG + Intergenic
1026274738 7:68866672-68866694 CTTACTTTCCAATCTGACTCTGG + Intergenic
1026308883 7:69166698-69166720 CTTACTTTCCAGTCTGACTCTGG - Intergenic
1026496688 7:70909651-70909673 CTTACTTTCCAACCTGACTCTGG - Intergenic
1026532163 7:71208960-71208982 CTTACTCTCCAGCCTGTTTCAGG - Intronic
1026562204 7:71459573-71459595 CTTACTTTCCAGTCTGACTCTGG + Intronic
1026571242 7:71532978-71533000 ATTACTCTCCGACCTCATGCAGG - Intronic
1026594585 7:71723798-71723820 CTTTCTTCCCAACCTCTTGCAGG - Intergenic
1026613895 7:71884707-71884729 TTTACTTTCCAACCCGACTCTGG + Intronic
1026661433 7:72306112-72306134 CTTACTTTCCAAACTGACACTGG + Intronic
1026997480 7:74627594-74627616 TTTACTTTCCACTCTGAGGCTGG + Intergenic
1027257144 7:76438235-76438257 CTGACATTCCATCCTGCTGCTGG - Intronic
1027281707 7:76613807-76613829 CTGACATTCCATCCTGCTGCTGG + Intronic
1027517806 7:79164282-79164304 CTTACTTTCCAATCTGACTCTGG + Intronic
1027972926 7:85109488-85109510 CTTAATTTCCAAACTGTTTCTGG + Intronic
1029332224 7:99868240-99868262 CTTACTTTCCAATCTGACTCTGG + Intergenic
1029931285 7:104373985-104374007 CTTACTTTCCAACCTGACTCTGG - Intronic
1030118055 7:106078656-106078678 CTTACTTTCCAATCTGACTCTGG + Intergenic
1030495069 7:110288618-110288640 CTTACTTTCCACCCTGACTGTGG + Intergenic
1031561363 7:123242740-123242762 TTAACTTTCCAACCTTATCCTGG + Intergenic
1032420301 7:131773877-131773899 ATGACTTTCCAACCTGACTCTGG + Intergenic
1033147623 7:138884650-138884672 CTTACTTTCTAACCTGACTCTGG + Intronic
1033162782 7:139012101-139012123 CTTACTTTCCAATCTGACTCTGG + Intergenic
1033610352 7:142958569-142958591 TTTACTTTCTAACCTGATTCTGG + Intronic
1033627717 7:143127371-143127393 CTTACTTTCCAATCTGACTCTGG + Intergenic
1034179941 7:149129193-149129215 CTTAGTTTCCAACCTGACTCTGG - Intronic
1035207936 7:157306889-157306911 CTTACTTTCCAATCTGACTCTGG - Intergenic
1035209168 7:157315028-157315050 CTTACTTTCCAATCTGACTCTGG + Intergenic
1035682523 8:1498449-1498471 CTCACTTTCCAACCTGACTCGGG - Intergenic
1036525214 8:9528667-9528689 CTTACTTTCCAACCTGACTCTGG + Intergenic
1036637605 8:10562674-10562696 CTTACTTTTCAGTCTGATTCCGG + Intergenic
1037367668 8:18140228-18140250 CTTACTTTCCAACCTGACTCTGG + Intergenic
1037413235 8:18619754-18619776 CTTACTCCCCAACCTGACTCTGG + Intronic
1038209792 8:25505824-25505846 GTTACTTACCAATCTGATGATGG + Intronic
1038739071 8:30200654-30200676 CTTACTTTCCAACCTGACTCTGG + Intergenic
1038745271 8:30249359-30249381 CTTACTTTCCAACCTGACTCTGG - Intergenic
1038988600 8:32841105-32841127 CTTACTTTCCAAACTGACTCTGG - Intergenic
1039062621 8:33583887-33583909 CTTACTTTCCAACCTGACTCTGG - Intergenic
1039142888 8:34413090-34413112 CTTACTTTCCAACCTGACTCTGG - Intergenic
1039301183 8:36210299-36210321 CTTACTTTCCAATCTGACTCTGG + Intergenic
1039814605 8:41082023-41082045 CTCACTTTCCAACCTGACTCTGG - Intergenic
1040089865 8:43386782-43386804 CTTATTTTCCAACCTGACTCTGG - Intergenic
1040417686 8:47209661-47209683 CTTACTTTCCAACCTGACTCTGG + Intergenic
1040714098 8:50226279-50226301 CTCACTTTCCAATCTGACTCTGG + Intronic
1041317647 8:56581123-56581145 CTCACTTTCCAACCTGACTCTGG + Intergenic
1041359811 8:57041199-57041221 CTTACTTTCCAATCTGACTCTGG - Intergenic
1041609309 8:59826126-59826148 CTTACTTTCCAATCGGACTCTGG + Intergenic
1041767576 8:61434993-61435015 CTTACTTTTCAATCTGACTCTGG - Intronic
1042068559 8:64905272-64905294 CTTAATTTCCAACCCGACTCTGG - Intergenic
1042068568 8:64905385-64905407 CTTACTTTCCAACATGATTCTGG - Intergenic
1042821532 8:72935332-72935354 CTTCCTTTTCCACATGATGCTGG + Intronic
1043596676 8:81895833-81895855 CTTACTTTCCAACCTGACTTTGG + Intergenic
1044645623 8:94440082-94440104 CTTACTTTCCGATCTGACTCTGG - Intronic
1045557064 8:103224824-103224846 CTTACTTTGCAATCTGACTCTGG - Intronic
1047114314 8:121823635-121823657 CTTACTTTCCAATCTGACTCTGG - Intergenic
1049168817 8:141144874-141144896 CTTACTTTCCAACCTGACTCTGG + Intronic
1049964334 9:764827-764849 CTTACTTTCCAAACTGACTCTGG + Intergenic
1050060696 9:1706655-1706677 CTTACTTTTCAATCTGACTCTGG + Intergenic
1050118414 9:2283790-2283812 CTTACTTTCCAATCTGACTCTGG - Intergenic
1050952567 9:11616534-11616556 TTTACTTTCCAACCTGACTCTGG - Intergenic
1050984485 9:12064793-12064815 CTTACTTTCCAATCTAACTCTGG - Intergenic
1052121916 9:24728876-24728898 CTTACTTTTCAATCTGACTCTGG + Intergenic
1052875566 9:33559437-33559459 TTTACTTTCTAACCTGATTCTGG - Intronic
1053078780 9:35156803-35156825 CTTACTTTCCAACCTGACTGTGG + Intergenic
1053500448 9:38584907-38584929 TTTACTTTCTAACCTGATTCTGG + Intergenic
1053660662 9:40274959-40274981 CTTCCTTTCTAACCTGATTCTGG - Intronic
1053911040 9:42904304-42904326 CTTCCTTTCCAACCTGATTCTGG - Intergenic
1054361675 9:64127858-64127880 CTTCCTTTCTAACCTGATTCTGG - Intergenic
1054372786 9:64421177-64421199 CTTCCTTTCTAACCTGATTCTGG - Intergenic
1054523948 9:66101325-66101347 CTTCCTTTCTAACCTGATTCTGG + Intergenic
1054680412 9:67910952-67910974 CTTCCTTTCTAACCTGATTCTGG - Intergenic
1055314372 9:75019258-75019280 CTTACTTTCCAACCTGACTCTGG + Intronic
1056390836 9:86140248-86140270 CTTACTTTCCAATCTGACTCTGG + Intergenic
1056642137 9:88380632-88380654 CTTACTTTCCAATCTGACTCTGG + Intergenic
1056802903 9:89706077-89706099 CTTACTTTCCAACCTGACTCTGG - Intergenic
1057348836 9:94277517-94277539 CTTACTTTCCAATCTGACTCTGG - Intronic
1057349345 9:94282140-94282162 CTTACTTTCCAATCTGACTCTGG - Intronic
1057679842 9:97169333-97169355 CTTACTTTCTAACCTGATTCTGG + Intergenic
1058531814 9:105913414-105913436 CTTACTTTCCAGTCTGACTCTGG + Intergenic
1059707048 9:116835276-116835298 CTTACTTTCCAATCTGGCTCTGG + Intronic
1060221546 9:121766632-121766654 CTCACTCTTCAACCTGCTGCAGG + Exonic
1061737105 9:132669358-132669380 CTTACTTTCCAAACTGGCTCTGG - Intronic
1061742630 9:132718149-132718171 CTTACTTTCCAATCTGACTCTGG + Intergenic
1062258784 9:135646711-135646733 CTTACTTTCCAACCTGTCTCTGG + Intergenic
1203692690 Un_GL000214v1:60250-60272 CTTCCTTTCTAATCTGATTCTGG + Intergenic
1203706367 Un_KI270742v1:52342-52364 CTTCCTTTCTAATCTGATTCTGG - Intergenic
1203556877 Un_KI270744v1:7142-7164 CTTCCTTTCTAATCTGATTCTGG + Intergenic
1203643605 Un_KI270751v1:43941-43963 CTTCCTTTCTAATCTGATTCTGG - Intergenic
1185590470 X:1273230-1273252 CTTACTTTCCAACCTGACTCTGG + Intronic
1185647658 X:1626570-1626592 CTCACTTTCCAACCTGACTCTGG - Intronic
1185660788 X:1727393-1727415 CTTACTTTCCCATCTGACTCTGG - Intergenic
1185712433 X:2314646-2314668 CTTACTTTCCAATGTGACTCTGG - Intronic
1185795568 X:2961497-2961519 CTTACTTTCCAATCTGACTCTGG + Intronic
1185842005 X:3400392-3400414 CTTACTTTCCAACCTGACTCTGG + Intergenic
1185983414 X:4804598-4804620 CTTACTTTCCAGTCTGACTCTGG - Intergenic
1186012869 X:5156522-5156544 CTTACTTTTCAACCTGACTCTGG + Intergenic
1186741758 X:12525465-12525487 CTTATGTTCCAACCTGACTCTGG + Intronic
1187806627 X:23128123-23128145 CTTACTTTCCAGTCTGACTCTGG + Intergenic
1188286051 X:28326677-28326699 CTTACTTTCCAATATGATTCTGG - Intergenic
1188390276 X:29611158-29611180 CTTCCTTTCCTTCCTGATCCAGG + Intronic
1188391327 X:29624007-29624029 ATAATTTTCAAACCTGATGCAGG - Intronic
1188439591 X:30202295-30202317 CTTACTTTCCAATCTGACTCTGG + Intergenic
1188807410 X:34608607-34608629 CTTACTTTCCAATCTGACTCTGG - Intergenic
1188841473 X:35023120-35023142 CTTACTTTCCAACCTGACTCCGG - Intergenic
1188876122 X:35432132-35432154 CCTACTTTCCAATCTGACTCTGG - Intergenic
1188881551 X:35497762-35497784 CTTATTTTCCAATCTGACTCTGG + Intergenic
1188884891 X:35537486-35537508 CTTACTTTCCAATCTGACTCTGG - Intergenic
1189081080 X:37973183-37973205 CTTACTTTTCAATCTGACTCTGG - Intronic
1189784574 X:44547974-44547996 CTTACTTTCCAAACTGACTCTGG - Intergenic
1189985758 X:46552054-46552076 CTTACTTTCCAACCTGACTCTGG - Intergenic
1190367465 X:49709758-49709780 CTTACTTTCCAACCTGACCCTGG - Intergenic
1190368562 X:49720406-49720428 CTTACTTTCCAACCTGACTCTGG - Intergenic
1190810709 X:53880784-53880806 CTTACTTTTCAATCTGAGTCTGG + Intergenic
1191189190 X:57648548-57648570 CTTACTTTCCAACCTGACACTGG - Intergenic
1191624713 X:63258112-63258134 CTTACTTTCCAATCTGACTCTGG - Intergenic
1191642478 X:63442282-63442304 CTTACTTTCCAATCTGACTCTGG + Intergenic
1192087610 X:68116370-68116392 CTTACTTTCCAATCTGACTCTGG - Intronic
1192703986 X:73509200-73509222 TTTACTTTCCAAACTGACTCTGG - Intergenic
1192728984 X:73783342-73783364 CTTACTTTCCAATCTGACTCTGG - Intergenic
1193539019 X:82747880-82747902 CTTACTTTCCGATCTGACTCTGG - Intergenic
1193660208 X:84248219-84248241 CTTACTTTCCAATCTGACTTTGG - Intergenic
1193716368 X:84939375-84939397 CTTACTTTCCAGTCTGACTCTGG - Intergenic
1194089376 X:89566187-89566209 CTTACTTTCCAACCTGACTCTGG - Intergenic
1194138819 X:90182030-90182052 CTTACTTTCCAATCTGACTCTGG + Intergenic
1194205882 X:91010532-91010554 CTTACTTTCCAAACTGACTCTGG + Intergenic
1194289270 X:92049320-92049342 CTTACTTTCCAATCTGACTCTGG - Intronic
1194292496 X:92092043-92092065 CTTACTTTCCAATCTGACTCGGG - Intronic
1194410607 X:93553219-93553241 CCTACTTTCCAATCTGACTCTGG - Intergenic
1194476355 X:94364414-94364436 CTTACTTTCCAATCCGACTCTGG + Intergenic
1195069043 X:101262109-101262131 CTATCTTTCCAACCAGAGGCTGG - Exonic
1196287475 X:113899119-113899141 CTTACTTTCCAATCTGACTCTGG - Intergenic
1196365998 X:114925084-114925106 CTTACTTTCCAGCCTGACTCTGG - Intergenic
1196487168 X:116225589-116225611 CTTACTTTCCAGCCTGACTCTGG - Intergenic
1197352577 X:125396032-125396054 CTTACTTTCCAACCTGACTCTGG - Intergenic
1197479202 X:126962111-126962133 CTTACTTTTCAATCTGACTCTGG + Intergenic
1197498123 X:127210930-127210952 CTTATTTTCCAACCTGATTCTGG + Intergenic
1197786844 X:130207036-130207058 CTCCATTTCCAACCTGATCCTGG - Intronic
1198434935 X:136607952-136607974 GTGACTTTCCAACCTGACTCTGG - Intergenic
1199081934 X:143586894-143586916 CTTACTTTCCAATCTGACTCTGG - Intergenic
1199279211 X:145980430-145980452 CTTTCTTTCCAATCTGACTCTGG + Intergenic
1199479451 X:148282115-148282137 CTTTCTTTGAAACCTGATGGTGG - Intergenic
1200293445 X:154893704-154893726 TTTACTTTCCAACCTTACTCTGG + Intronic
1200410852 Y:2860052-2860074 CTTACTTTCCAGTCTGACTCTGG + Intronic
1200425285 Y:3013696-3013718 CTTACTCTCCAATGTGATTCTGG - Intergenic
1200442036 Y:3222234-3222256 CTTACTTTCCAACCTGACTCTGG - Intergenic
1200484622 Y:3752263-3752285 CTTACTTTCCAATCTGACTCTGG + Intergenic
1200551638 Y:4585343-4585365 CTTACTTTCCAAACTGACTCTGG + Intergenic
1200606788 Y:5273903-5273925 CTTACTTTCCAATCTGACTCTGG - Intronic
1200610008 Y:5316619-5316641 CTTACTTTCCAATCTGACTCGGG - Intronic
1200801465 Y:7390952-7390974 CTTACTTTCCAGTCTGACTCTGG + Intergenic
1201233452 Y:11888290-11888312 CTTACTTTCCAACCTGACTCTGG - Intergenic
1201257485 Y:12123379-12123401 CTTTATTTCAAACCTGATGTGGG - Intergenic
1201694460 Y:16809517-16809539 CTTACTTTCCAATCTGACTCTGG + Intergenic
1201942449 Y:19474409-19474431 CTTGCTTTACAGCCAGATGCAGG - Intergenic
1202050257 Y:20773526-20773548 CTTACTTTCCAGCCTGACACTGG + Intronic
1202060108 Y:20877851-20877873 CTTACTTTCCGATCTGATTCCGG - Intergenic
1202063149 Y:20909396-20909418 CTTACTTTCCAATCCAATTCTGG - Intergenic
1202090645 Y:21185097-21185119 CATACTTTCCAATCTGGTGTTGG - Intergenic