ID: 1184579488

View in Genome Browser
Species Human (GRCh38)
Location 22:45404991-45405013
Sequence ATGTGCTAGTACAAGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184579488 Original CRISPR ATGTGCTAGTACAAGGGAGG GGG Intronic
902005869 1:13231441-13231463 AATTGCTTGAACAAGGGAGGTGG + Intergenic
902666126 1:17939840-17939862 ATGTGCTATATCAAGGGAGTTGG - Intergenic
902954814 1:19918343-19918365 CTGTGCTAGCAAAAGGAAGGAGG - Intergenic
903816008 1:26065108-26065130 AATTGCTTGAACAAGGGAGGCGG - Intronic
904304047 1:29575577-29575599 ATGTGTGATTTCAAGGGAGGAGG + Intergenic
905564488 1:38952833-38952855 AATTGCTTGTACCAGGGAGGTGG + Intergenic
906237678 1:44221697-44221719 AGGTGCTCTTACAAGGGTGGGGG + Intronic
906864149 1:49397693-49397715 AGGAGCTAGTATAAGGGAGAAGG - Intronic
906985441 1:50678273-50678295 ATGGGATAGTTCAAGGGGGGTGG + Intronic
907285748 1:53378380-53378402 ATGTGGCAGAACAAGGCAGGAGG + Intergenic
907761195 1:57362518-57362540 ATGTGATGGTATTAGGGAGGTGG + Intronic
907875464 1:58482761-58482783 AGCTGCGAGTACAAGGGAGATGG + Intronic
908119054 1:60968456-60968478 ATGTGCGTGTGCAAGGGAAGGGG + Intronic
909945038 1:81654401-81654423 ATGGGCTTGAATAAGGGAGGTGG - Intronic
911130385 1:94381657-94381679 AATTGCTTGAACAAGGGAGGTGG + Intergenic
911993925 1:104738092-104738114 ATGAGCAACTACAAGGTAGGAGG + Intergenic
912351930 1:109022089-109022111 ATTTGCGAGTCCAAGGCAGGCGG - Intronic
912433440 1:109641899-109641921 ATGGGCTACTAGAGGGGAGGTGG + Intergenic
915465709 1:156096823-156096845 ATGAGCAAGCGCAAGGGAGGTGG - Intronic
915568526 1:156730643-156730665 AATTGCTAGAACCAGGGAGGCGG + Intronic
919442095 1:197648530-197648552 AGGTGCTAAGACAATGGAGGTGG - Intronic
921206817 1:212856744-212856766 ATGTGTTGGTGCAAGGGAGAAGG + Intergenic
923901544 1:238331407-238331429 ATGTTGTAGCACAAAGGAGGGGG - Intergenic
1068489592 10:57706351-57706373 ATGTTCAAGGAAAAGGGAGGAGG + Intergenic
1069539841 10:69285693-69285715 ATGTGCGAGTACCAGAGAGAGGG + Intronic
1070599444 10:77855627-77855649 ATGTGCTAGCACATGAGAGTTGG - Intronic
1072492899 10:95925786-95925808 ATTTGCTAGCAAAAGGGAAGTGG + Intronic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1073789203 10:106922602-106922624 CTGTGTGTGTACAAGGGAGGGGG - Intronic
1074853202 10:117455198-117455220 ATGTGCTGGGCCAAGAGAGGTGG + Intergenic
1077127658 11:949686-949708 AAGTGCTAGAACCCGGGAGGCGG + Intronic
1077587639 11:3466086-3466108 ATTTGCTTGAACATGGGAGGTGG + Intergenic
1078394448 11:10967677-10967699 AATTGCTTGAACAAGGGAGGTGG - Intergenic
1080403069 11:31955034-31955056 ATGGACTAATACAAGGGAAGAGG + Intronic
1083166820 11:60893830-60893852 CTGTGCTAGAACCTGGGAGGTGG + Intronic
1086074232 11:82833278-82833300 AGGTGCTAGTAGAAGTAAGGGGG + Intronic
1086416596 11:86594957-86594979 ATGAGCTAGGACAAGCCAGGTGG + Intronic
1088918209 11:114242943-114242965 AGGTGATGGGACAAGGGAGGGGG + Intronic
1089620617 11:119720215-119720237 AGGTGCTAGGACAAGGGCAGTGG - Intronic
1094639739 12:32262360-32262382 ACTTGCTAGTACCAGGGATGGGG - Intronic
1095583892 12:43829999-43830021 ATGTGCTTGAACCCGGGAGGCGG + Intergenic
1097003480 12:55898178-55898200 ATTTGAGAGTACAAGGCAGGCGG + Intergenic
1098020555 12:66150871-66150893 ATGTAATAGAACAAGGGAGAGGG + Intronic
1102070088 12:110011468-110011490 ATGTGCTACTTCAAGGCACGTGG + Intronic
1104884770 12:132100366-132100388 CTGTGCTTGTACCTGGGAGGAGG - Intronic
1105309555 13:19194275-19194297 AATTGCTTGAACAAGGGAGGTGG - Intergenic
1107934977 13:45338641-45338663 ATGTGTAAGTACAAGGAAGTGGG - Exonic
1108549201 13:51526318-51526340 ATGTTCAAGTTCAAGGGAGTTGG + Intergenic
1109696793 13:65971686-65971708 AGGTGTGTGTACAAGGGAGGAGG + Intergenic
1110368133 13:74710529-74710551 ATATGGTAGTACAAAGGAAGAGG + Intergenic
1112317583 13:98377213-98377235 AATTGCTTGAACAAGGGAGGTGG + Intronic
1116259892 14:42611997-42612019 AAGTGCTTGAACCAGGGAGGCGG - Intergenic
1117047908 14:51831208-51831230 ATGTGCTAACACAAAGGAGGAGG - Intronic
1119751369 14:77080213-77080235 ATGTTCTGGTTCAAGGGAAGGGG - Intergenic
1202908880 14_GL000194v1_random:98743-98765 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1124497473 15:30195544-30195566 AGGTGCTGGGTCAAGGGAGGAGG + Intergenic
1124746100 15:32343121-32343143 AGGTGCTGGGTCAAGGGAGGAGG - Intergenic
1124973850 15:34515189-34515211 AGGTGCTGGGTCAAGGGAGGAGG - Intergenic
1125698240 15:41657438-41657460 AATTGCTTGAACAAGGGAGGTGG - Intronic
1126319317 15:47405208-47405230 GTGTGTTAGTAGCAGGGAGGAGG + Intronic
1128091759 15:64923870-64923892 ATGTTCTAGAATGAGGGAGGCGG + Intronic
1130042656 15:80418165-80418187 ATGTGCTTGTTGAAGAGAGGGGG + Intronic
1130380023 15:83363627-83363649 TTGTGCTATTACAAGGCAGAGGG - Intergenic
1130568607 15:85020515-85020537 AAGTGCTTGAACACGGGAGGTGG + Intronic
1131770476 15:95731660-95731682 AATTGCTAGAACACGGGAGGTGG + Intergenic
1134766546 16:16763775-16763797 ATCTACTGGTACAAGGTAGGGGG - Intergenic
1137327508 16:47456603-47456625 AATTGCTAGAACCAGGGAGGTGG + Intronic
1137789103 16:51159703-51159725 ATCTGAAAGCACAAGGGAGGGGG - Intergenic
1140812664 16:78593397-78593419 ATGGGATAGTACAAGGGTGATGG - Intronic
1141366653 16:83449834-83449856 ATGAGCTAATGCAAGGGAGAGGG + Intronic
1146159010 17:30549388-30549410 ATGTGGTAATGCAAGGGATGGGG - Intergenic
1146522000 17:33532603-33532625 AGGTGCTAGTGCAATGGATGGGG + Intronic
1147163150 17:38579275-38579297 ATATGCTAGTCTGAGGGAGGAGG - Intronic
1147287136 17:39411230-39411252 AATTGCTTGAACAAGGGAGGCGG + Intronic
1147928667 17:43962211-43962233 ATGTGCTATTAGAAGGAATGGGG + Intronic
1148353570 17:46958615-46958637 ATGTGCCAGCTCAGGGGAGGGGG + Intronic
1148989791 17:51655960-51655982 GTGTGGGGGTACAAGGGAGGGGG - Intronic
1149327328 17:55545283-55545305 AATTGCTAGAACACGGGAGGTGG + Intergenic
1149488286 17:57062454-57062476 ATGTGCTTGAACCCGGGAGGTGG - Intergenic
1151747515 17:76019225-76019247 ATCTGCTAGTTGCAGGGAGGGGG + Intronic
1154311958 18:13273815-13273837 CTGTCCTGGTGCAAGGGAGGTGG + Intronic
1156089276 18:33445344-33445366 ATGGGCTAGTGTGAGGGAGGGGG + Intergenic
1156706229 18:39886067-39886089 GTGTGCGAATACAAGAGAGGAGG - Intergenic
1156785300 18:40905727-40905749 AACTGCTAGAACACGGGAGGCGG - Intergenic
1157893391 18:51440647-51440669 CTGTGCTATTACAATAGAGGAGG - Intergenic
1158342706 18:56484110-56484132 AAGTGCAATTATAAGGGAGGGGG - Intergenic
1159281906 18:66296528-66296550 ATGTGCTTGAACTTGGGAGGCGG - Intergenic
1163557389 19:18000505-18000527 AATTGCTAGAACCAGGGAGGTGG + Intergenic
1163687283 19:18719048-18719070 ACGGGCTAGTACCAGGGAGGGGG + Intronic
1163777304 19:19226014-19226036 AATTGCTTGAACAAGGGAGGTGG - Intronic
1167378216 19:49123525-49123547 ATTTGCTTGAACACGGGAGGCGG - Intronic
1168027861 19:53656589-53656611 AATTGCTTGTACCAGGGAGGTGG - Intergenic
1202633540 1_KI270706v1_random:21971-21993 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1202652341 1_KI270707v1_random:18096-18118 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
927877350 2:26667216-26667238 CTGTGCTAATAAAATGGAGGTGG - Intergenic
929448424 2:42018842-42018864 AAGTGCTTGAACACGGGAGGTGG + Intergenic
931597899 2:63970134-63970156 GAGAGCTAGTACAAGGGAAGAGG - Intronic
932623288 2:73279414-73279436 ATGAGCAAGTCCAAGGGAGAGGG + Intronic
937006223 2:118518848-118518870 ATGTGCTACTGAAAGGCAGGGGG + Intergenic
937416093 2:121715703-121715725 AATTGCTTGAACAAGGGAGGCGG + Intergenic
938139800 2:128786115-128786137 AAGTGCTTGAACCAGGGAGGTGG + Intergenic
939722469 2:145671557-145671579 ATGTGCTACTCCAAGGTGGGTGG + Intergenic
940762955 2:157758087-157758109 ATGTGCCTTTACAAGTGAGGTGG - Intronic
941647517 2:168057277-168057299 AATTGCTAGAACACGGGAGGTGG - Intronic
941869723 2:170371542-170371564 AAGTAATAGTACAAGAGAGGTGG - Intronic
941873119 2:170406421-170406443 AAATTCTAGTACAAGGGAAGGGG + Intronic
942011492 2:171766874-171766896 ATGTGCAAGTAAAAAAGAGGAGG + Intergenic
942997659 2:182283784-182283806 AAGTGAAAGTACAAAGGAGGAGG + Intronic
943601182 2:189923062-189923084 AATTGCTAGAACATGGGAGGCGG + Intronic
944131537 2:196352699-196352721 ATGTACTAGGCAAAGGGAGGAGG + Intronic
944536080 2:200711221-200711243 ATTTGCTTGAACCAGGGAGGTGG + Intergenic
946729536 2:222695352-222695374 AGGTGCTAATGCAAGGGAAGTGG + Intronic
948882411 2:240866688-240866710 TTTTGCTATTTCAAGGGAGGCGG - Intergenic
1168759078 20:336474-336496 AACTGCTTGTACCAGGGAGGCGG - Intergenic
1169608977 20:7357876-7357898 ATGAGGTTGGACAAGGGAGGAGG - Intergenic
1171793535 20:29548887-29548909 AGGTGCTAGTAAACGGGATGAGG - Intergenic
1172617635 20:36299540-36299562 AGGTACTACTGCAAGGGAGGTGG + Intergenic
1174248946 20:49203771-49203793 ATTTGCTTGAACCAGGGAGGTGG - Intergenic
1175639817 20:60619596-60619618 ACGTCCAAGCACAAGGGAGGCGG + Intergenic
1176599806 21:8781557-8781579 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1176645753 21:9347835-9347857 CTGTGTGAGTCCAAGGGAGGTGG + Intergenic
1177584245 21:23069519-23069541 ATTTGCTTGAACCAGGGAGGCGG - Intergenic
1180367173 22:11951319-11951341 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1180378907 22:12120018-12120040 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1182644232 22:31795155-31795177 AATTGCTTGTACTAGGGAGGCGG - Intronic
1183777777 22:39978769-39978791 ATTTGCTTGAACCAGGGAGGTGG - Intergenic
1183873900 22:40762582-40762604 AATTGCTGGAACAAGGGAGGTGG + Intergenic
1184579488 22:45404991-45405013 ATGTGCTAGTACAAGGGAGGGGG + Intronic
952209612 3:31216279-31216301 ATCTGCTAGTGCAAGCAAGGGGG + Intergenic
953259722 3:41325830-41325852 AATTGCTAGAACCAGGGAGGTGG + Intronic
954672199 3:52297158-52297180 ATATGCTAGGGGAAGGGAGGGGG + Intergenic
954804130 3:53205725-53205747 ATTTGCTTGAACCAGGGAGGCGG + Intergenic
956271448 3:67451822-67451844 ATGTAGTGGTACAAGGGAAGAGG + Intronic
957765333 3:84617361-84617383 AAGCGCTTGTACATGGGAGGTGG - Intergenic
959544528 3:107578729-107578751 ATGGGCTTCTTCAAGGGAGGAGG - Intronic
960034034 3:113085291-113085313 ATTTGCTTGAACCAGGGAGGTGG - Intergenic
963026563 3:140924880-140924902 TTGTGCTTGTTCAAGGCAGGAGG + Intergenic
963567624 3:146949190-146949212 AATTGCTAGAACGAGGGAGGAGG - Intergenic
963866799 3:150370223-150370245 ATGTGCTAGAAAAGGAGAGGAGG + Intergenic
967024062 3:185548316-185548338 AATTGCTAGAACCAGGGAGGCGG + Intronic
968741194 4:2332551-2332573 CTGTGCTTGTACCAGGGAGATGG - Intronic
972537491 4:40011648-40011670 ATGTGCTGGGTCAGGGGAGGTGG - Intergenic
973363164 4:49183979-49184001 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
973397929 4:49612881-49612903 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
974020268 4:56686906-56686928 CTGTGCTAGTAGAAAGCAGGGGG + Intergenic
975017034 4:69434416-69434438 AATTGCTTGAACAAGGGAGGTGG + Intergenic
978389040 4:108205202-108205224 AAGTGCTCGCACAAAGGAGGGGG - Intergenic
979021172 4:115500668-115500690 AGGTGTTAGTATAAGGGAGGAGG + Intergenic
983167861 4:164498773-164498795 TTGTGATTGGACAAGGGAGGTGG + Intergenic
983252137 4:165357434-165357456 ATGTGCTAGTTCAGGGCAGTGGG + Intergenic
983386423 4:167069148-167069170 ATATGCTATTCAAAGGGAGGAGG - Intronic
1202760525 4_GL000008v2_random:105497-105519 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
986790190 5:11152087-11152109 ATGTGTTAGTAAGAGAGAGGTGG + Intronic
989988080 5:50726737-50726759 ATATGCAAGTACAAAGGAGACGG + Intronic
992064265 5:73091136-73091158 AAGTGCTTGAACACGGGAGGTGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998073197 5:139215141-139215163 ATGTGTGTGTACTAGGGAGGAGG - Intronic
998255432 5:140583321-140583343 AATTGCTTGAACAAGGGAGGTGG + Intronic
999245772 5:150153901-150153923 ATGTCCTGGTGAAAGGGAGGAGG - Intronic
1001393255 5:171397878-171397900 AATTGCTTGAACAAGGGAGGAGG - Intronic
1008417198 6:51255642-51255664 AGGTGCTAGTCTCAGGGAGGTGG - Intergenic
1009583800 6:65569977-65569999 ATGTGGAAGGACAAGGGAGTTGG + Intronic
1011722231 6:90169424-90169446 CTGTGCAAGTATCAGGGAGGGGG - Intronic
1011724821 6:90199617-90199639 ATTTCCCAGTACAAGGCAGGTGG + Intronic
1016087468 6:139931895-139931917 ATGAGGTCCTACAAGGGAGGAGG + Intergenic
1016441456 6:144088581-144088603 ATTTGCTAGTCTAAGAGAGGTGG + Intergenic
1021085742 7:16420105-16420127 AGGTTCTAGTCCAAGGGAAGTGG - Intronic
1021171761 7:17405923-17405945 ATGAGATAATACAAGGGAGAAGG + Intergenic
1022081801 7:27029893-27029915 AATTGCTAGAACCAGGGAGGAGG + Intergenic
1022514465 7:30966468-30966490 ATGTGCAAGGACAAGGGAAGTGG - Intronic
1026581068 7:71617727-71617749 AAGTGCTTGAACCAGGGAGGTGG - Intronic
1026956726 7:74380997-74381019 ATGTACTCCTGCAAGGGAGGAGG + Intronic
1030275702 7:107719347-107719369 ATGTTCTAGTATAAGCGAGGCGG - Intergenic
1031298205 7:120032161-120032183 AAGTGCTAGAACTCGGGAGGCGG - Intergenic
1032180786 7:129675356-129675378 ATGTGCAAGTACATGGGAGGAGG - Intronic
1035489804 7:159264640-159264662 ATGTAATAAGACAAGGGAGGAGG + Intergenic
1036194528 8:6702164-6702186 ATGTGCTAAGGCAAGGCAGGGGG + Intergenic
1037505099 8:19521594-19521616 AATTGCTTGTACATGGGAGGCGG + Intronic
1041797529 8:61760922-61760944 AAGTGCAAGTACAGGGGAAGTGG - Intergenic
1042885555 8:73546026-73546048 AAGTGCTTGAACCAGGGAGGCGG - Intronic
1045394755 8:101749857-101749879 ATGTGGAAGTAAAAGGGATGAGG - Intronic
1046695417 8:117334013-117334035 ATGCGCTAGAACAAGAGAGAAGG + Intergenic
1047073535 8:121374791-121374813 ATGTGATAGAAGAAGGCAGGAGG + Intergenic
1047303928 8:123638074-123638096 ATGTGCTGGAACAAGGAAAGGGG - Intergenic
1048750610 8:137669765-137669787 ATTTGCTGGTACAAGTGTGGTGG - Intergenic
1052553352 9:29981620-29981642 ATCTGCTTGTACCTGGGAGGCGG - Intergenic
1053792754 9:41698781-41698803 AGGTGCTAGTAAACGGGATGAGG + Intergenic
1054181167 9:61910802-61910824 AGGTGCTAGTAAACGGGATGAGG + Intergenic
1054472194 9:65547187-65547209 AGGTGCTAGTAAACGGGATGAGG - Intergenic
1054656424 9:67670340-67670362 AGGTGCTAGTAAACGGGATGAGG - Intergenic
1056753770 9:89369636-89369658 ATGTGCTGGCACACGGGTGGTGG + Intronic
1057201605 9:93143462-93143484 ATATGCCAGTCCAAGGAAGGTGG + Intergenic
1057433680 9:95019928-95019950 ATGTGCTAGTCCTAAGGAGAAGG + Intronic
1058432797 9:104933696-104933718 AGGTGTTAATAAAAGGGAGGGGG - Intergenic
1059657561 9:116369907-116369929 ATGTGGTAGAAAAAGGGAGGAGG + Intronic
1060437149 9:123603662-123603684 ATGTGGTAGTTCAAGGCAGTAGG - Intronic
1062585192 9:137246100-137246122 AGGGGCTGGTACAAGGCAGGCGG - Intronic
1203709770 Un_KI270742v1:87160-87182 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1203541297 Un_KI270743v1:90383-90405 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1186641854 X:11463943-11463965 ATGTGCTAGGAAGATGGAGGAGG + Intronic
1187420632 X:19130645-19130667 ATGTGATAGTATTAGGGAGTGGG + Intergenic
1189719894 X:43905341-43905363 ACGTGCTAGTTCCAGGGATGGGG + Intergenic
1192784514 X:74323371-74323393 CTGGACTAGTACAAGGGTGGGGG + Intergenic
1193358843 X:80556280-80556302 ATGTGCTAAAAAAAGGTAGGGGG - Intergenic
1194555239 X:95350247-95350269 ATGTGTCTGTACTAGGGAGGAGG - Intergenic
1196323963 X:114379279-114379301 ATGTGCTCCCACAAGGGATGAGG + Intergenic
1196627141 X:117889485-117889507 CTGAGCAAGAACAAGGGAGGAGG - Intergenic
1196822557 X:119713723-119713745 AATTGCTTGTACCAGGGAGGCGG - Intergenic
1198877749 X:141245259-141245281 AATTGCTTGTACATGGGAGGCGG - Intergenic
1198908356 X:141586939-141586961 AATTGCTTGTACATGGGAGGCGG + Intronic