ID: 1184580328

View in Genome Browser
Species Human (GRCh38)
Location 22:45412956-45412978
Sequence ACTGCTCTTGCCCTTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 267}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184580328_1184580343 26 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580343 22:45413005-45413027 ACAGGGCCCAGGGCGGGACCGGG 0: 1
1: 0
2: 2
3: 43
4: 446
1184580328_1184580331 -4 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580331 22:45412975-45412997 CAGTCCCCGAAGCAGGAGTGAGG 0: 1
1: 0
2: 3
3: 36
4: 535
1184580328_1184580345 30 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580345 22:45413009-45413031 GGCCCAGGGCGGGACCGGGGCGG 0: 1
1: 0
2: 5
3: 90
4: 667
1184580328_1184580341 20 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580341 22:45412999-45413021 CAGAGAACAGGGCCCAGGGCGGG 0: 1
1: 2
2: 9
3: 90
4: 660
1184580328_1184580344 27 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580344 22:45413006-45413028 CAGGGCCCAGGGCGGGACCGGGG 0: 1
1: 0
2: 2
3: 58
4: 480
1184580328_1184580337 9 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580337 22:45412988-45413010 AGGAGTGAGGGCAGAGAACAGGG 0: 2
1: 1
2: 7
3: 99
4: 748
1184580328_1184580338 15 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580338 22:45412994-45413016 GAGGGCAGAGAACAGGGCCCAGG 0: 1
1: 0
2: 5
3: 79
4: 716
1184580328_1184580332 -3 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580332 22:45412976-45412998 AGTCCCCGAAGCAGGAGTGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1184580328_1184580336 8 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580336 22:45412987-45413009 CAGGAGTGAGGGCAGAGAACAGG No data
1184580328_1184580339 16 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580339 22:45412995-45413017 AGGGCAGAGAACAGGGCCCAGGG No data
1184580328_1184580340 19 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580340 22:45412998-45413020 GCAGAGAACAGGGCCCAGGGCGG 0: 1
1: 0
2: 6
3: 72
4: 685
1184580328_1184580342 25 Left 1184580328 22:45412956-45412978 CCAGGGCCAAGGGCAAGAGCAGT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1184580342 22:45413004-45413026 AACAGGGCCCAGGGCGGGACCGG 0: 1
1: 0
2: 1
3: 18
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184580328 Original CRISPR ACTGCTCTTGCCCTTGGCCC TGG (reversed) Intronic
900151477 1:1180961-1180983 CCTGCCCTTGCCCCTGCCCCTGG + Intronic
900151501 1:1181019-1181041 CCTGCCCTTGCCCCTGCCCCTGG + Intronic
900506888 1:3033863-3033885 AGTGCTCTAGCCCCTGTCCCTGG + Intergenic
900565747 1:3331116-3331138 GCTGCTCCTGCCCTTCGGCCTGG + Intronic
900805394 1:4764036-4764058 TCTTCTCCTGCCCTTGGCCTTGG + Intronic
900873704 1:5326036-5326058 TTTGCTCTTCCCCTTGGGCCTGG - Intergenic
902038345 1:13473816-13473838 TCTTCTCCTGCCCTTGGCCTGGG + Intergenic
902143104 1:14373383-14373405 TCTTCTCTTGCTCTTGGACCGGG - Intergenic
902373464 1:16019128-16019150 ACTGACCTTGCCCTGGGCCAGGG + Intronic
902387827 1:16085830-16085852 ACTGCTCCTCCCCATGTCCCTGG + Intergenic
903515725 1:23909582-23909604 GAGGCTCTAGCCCTTGGCCCAGG - Intronic
904201970 1:28825764-28825786 CCTGCTGTTGGCCTTGTCCCAGG - Intronic
904321241 1:29698897-29698919 CCTGCTCCTGCCCCTGCCCCTGG + Intergenic
904541976 1:31239533-31239555 GCTGCACTTGCCCATGGCTCCGG + Exonic
906099985 1:43254086-43254108 CCTGCTCTTGCTCTTGGATCTGG - Intronic
906104351 1:43283053-43283075 TCTGCTGTGGCCCCTGGCCCAGG - Exonic
907306796 1:53517795-53517817 CCTGCCCTTGCCCCTGCCCCGGG + Intronic
908461094 1:64348841-64348863 GCTGCACTTGCCCATGGCCTGGG - Intergenic
909189846 1:72538395-72538417 CCTGCTATTGCCCTTGCCACAGG - Intergenic
911098523 1:94075743-94075765 ACCACTCTTGCCCATGGGCCAGG - Intronic
912688863 1:111788583-111788605 AGTGTTCATGCCCTTTGCCCTGG + Intronic
912748747 1:112268124-112268146 AGGGCTCATGGCCTTGGCCCAGG - Intergenic
913621892 1:120619916-120619938 ACAGGTCTTGCCCTTTGCTCAGG - Intergenic
915298582 1:154939131-154939153 GCTGCTCAATCCCTTGGCCCTGG + Intergenic
915903385 1:159862004-159862026 ACTTCCCTGCCCCTTGGCCCTGG + Intronic
915905782 1:159876016-159876038 ACTGCTCTTGCCCATTCCACAGG - Intronic
916244211 1:162670917-162670939 GCTGCTTTTTCCTTTGGCCCTGG + Intronic
917504915 1:175618847-175618869 ACTGCCCTTGCCTTCTGCCCAGG + Intronic
924728923 1:246694566-246694588 TCTGCTTTTGCCCTTTGCCTTGG + Intergenic
1063429521 10:5977120-5977142 ACTGCTCCTGACCTCGGCCTCGG + Intronic
1063752726 10:8969216-8969238 TCTGCTCCTACCCATGGCCCTGG - Intergenic
1065073175 10:22048926-22048948 ACTGGACTGGCCCATGGCCCTGG - Intergenic
1067542398 10:47165538-47165560 GCTGCTCTTCCCCCTGCCCCAGG - Intergenic
1068160889 10:53262649-53262671 ACTTCTATTGCCTTTGTCCCAGG + Intergenic
1070800088 10:79240052-79240074 ACTCCTCCTGCCGTGGGCCCTGG - Intronic
1073242806 10:102069205-102069227 ACTGTTCTTGCCAGAGGCCCAGG + Intergenic
1073638091 10:105219995-105220017 ACTGCTCTTGGCCTTACCCTGGG + Intronic
1075099935 10:119499088-119499110 ACTGAGCCTGACCTTGGCCCTGG + Intergenic
1075200816 10:120402410-120402432 AATGCTCTTCCCCTTGCCCTAGG - Intergenic
1075322545 10:121503761-121503783 ACTTCTCTTGGCCATGTCCCAGG - Intronic
1076659858 10:132048318-132048340 TCTGCTCCTGGCCTTGGCACCGG + Intergenic
1077141019 11:1024883-1024905 GCTGCACTTGCGCTCGGCCCAGG + Exonic
1077405327 11:2379981-2380003 ACTGCTCTGGTCCTGGGCCTCGG + Intronic
1078019278 11:7641771-7641793 ACTTCTCCTTCTCTTGGCCCTGG - Intronic
1079053949 11:17188931-17188953 GCTGCTCTTACCCTTGCCTCAGG - Intronic
1079457376 11:20648645-20648667 ACTGCACTTGCCCTCTTCCCCGG + Intronic
1083659227 11:64244619-64244641 GCTCCTCGTGCCCCTGGCCCAGG - Exonic
1084675196 11:70630051-70630073 ACTGCTTTTGCTCCTGGCCCTGG + Intronic
1084677502 11:70644546-70644568 GCTGGTCCTGCCCTTGGCCGGGG - Intronic
1085762312 11:79252645-79252667 TCTCCTCGTGCCCTTTGCCCTGG + Intronic
1087266339 11:96065906-96065928 CCTGCTCTTGTGCTGGGCCCAGG + Intronic
1088384566 11:109239086-109239108 TCTTCTCTTGCCCTTGGCCTGGG + Intergenic
1088796522 11:113270350-113270372 CATGTCCTTGCCCTTGGCCCCGG - Exonic
1089211611 11:116807821-116807843 ACTGGGCTTGGCCTTGGCTCAGG - Intergenic
1089626533 11:119754724-119754746 ACTGCCCATCCCCTTGGCCAGGG + Intergenic
1090550964 11:127819534-127819556 ACTGCCCTTTCTCTAGGCCCAGG - Intergenic
1091191386 11:133698351-133698373 CCTGCCCTTGACCTTGGGCCAGG - Intergenic
1094490689 12:30958769-30958791 ACTGCCCCTGCCCCTGCCCCAGG - Intronic
1094846569 12:34363972-34363994 ACTGCACATGCCATGGGCCCAGG - Intergenic
1095101061 12:38184282-38184304 TCTGCACTTGCCCTGGGCCAAGG + Intergenic
1095946259 12:47755517-47755539 TCTGATCTTGCCCCTGCCCCCGG + Intronic
1096664581 12:53154718-53154740 ACCCATCTTGCCCTTGGCCTGGG - Intergenic
1096961770 12:55586120-55586142 ACTGCTCTTCCACTTGTTCCTGG - Intergenic
1097459188 12:59839137-59839159 ACTGCTTTTGCCTTCTGCCCAGG - Intergenic
1099007134 12:77247466-77247488 GCTGCTCTTTCCTTTGGCACAGG - Intergenic
1100089148 12:90949063-90949085 TCTGCCCCTGCCCTTGCCCCAGG - Intronic
1101789199 12:107912420-107912442 TCTGCACTTACCCTTGGTCCTGG - Intergenic
1102037710 12:109781704-109781726 ACTGCAGCTGCCCTTGGCCTTGG + Intergenic
1102628350 12:114254641-114254663 AGTGCTCATTCCCTTGGCCAGGG - Intergenic
1103686912 12:122739450-122739472 ACAGGTCTTGCCCTTTGCCCAGG + Intergenic
1104506447 12:129336797-129336819 CCTGCTGCTGCCCTCGGCCCAGG - Intronic
1105805306 13:23948736-23948758 CCTGCTCTGACCCTGGGCCCAGG - Intergenic
1106066692 13:26359207-26359229 ACTGCTCCTCCCCTCAGCCCTGG - Intronic
1111122994 13:83879102-83879124 AGTGCCCTCGCCCTCGGCCCCGG - Exonic
1111286009 13:86092580-86092602 ATTGATCTTTCCTTTGGCCCAGG - Intergenic
1111338035 13:86847476-86847498 ACTCCTGTTGCCCTTGGTCTGGG + Intergenic
1112196238 13:97229364-97229386 AATAATCTTGCCCTTGGCCCGGG - Intronic
1114614822 14:24062756-24062778 ACAGATCCTGCCCTTGGCCTGGG - Exonic
1115663629 14:35523028-35523050 AATGCTCTTCCCCTTGACTCTGG - Intergenic
1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG + Intronic
1119516522 14:75252782-75252804 ATTGCCCTTGCCCTGGACCCTGG - Intronic
1121018923 14:90567060-90567082 CCTGCTCTGGGCCCTGGCCCTGG - Intronic
1121096186 14:91219674-91219696 CCCACTCTGGCCCTTGGCCCAGG + Intronic
1121336426 14:93080264-93080286 GCTGCCCTTGCCCTTGACCAGGG - Intronic
1121815329 14:96924337-96924359 ACTGCTCTTTCCCAGTGCCCAGG + Intronic
1122141202 14:99664108-99664130 CCTGCTTTTGTCCTTGGCCCCGG + Intronic
1122152330 14:99731802-99731824 TGGGCTCTTGCCCTGGGCCCAGG - Intergenic
1122836074 14:104431720-104431742 ACTGCCCCTTCCCTTGGCCCAGG - Intergenic
1122995622 14:105262248-105262270 GCTGCTCATGACCTAGGCCCTGG - Intronic
1123001844 14:105300067-105300089 ATTGCTGCTGCCCTTGGCCTTGG - Intronic
1202899214 14_GL000194v1_random:26028-26050 TCAGCTCTTGCGCTGGGCCCAGG - Intergenic
1124532249 15:30518091-30518113 CCTGCTCAGGCCCCTGGCCCTGG - Intergenic
1124766404 15:32489554-32489576 CCTGCTCAGGCCCCTGGCCCTGG + Intergenic
1126909967 15:53407480-53407502 ACTGCACTTACACCTGGCCCAGG - Intergenic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127300431 15:57647730-57647752 CCTGCACTTGGCCCTGGCCCTGG + Intronic
1128586239 15:68852844-68852866 ACAGCTCTTGCCCCTCACCCTGG - Intronic
1128619106 15:69133792-69133814 ACTGTCCTTGCCCTAGACCCGGG + Intergenic
1128728455 15:70004999-70005021 CCTGCCCTGGCCCTGGGCCCTGG + Intergenic
1128791041 15:70434171-70434193 GCTTCTCTTTGCCTTGGCCCTGG - Intergenic
1129177223 15:73848669-73848691 TCTGCTCCTGCACTTGGCTCTGG - Intergenic
1129977040 15:79831229-79831251 GCTGCTCTTGCCCTGGCCCAGGG + Intergenic
1130046988 15:80453275-80453297 ACAGGTCCTGCCCTTGCCCCTGG - Intronic
1130932317 15:88438309-88438331 ACAGCTCTGGGCCTGGGCCCTGG + Intergenic
1130990529 15:88873201-88873223 CTTGCCCTTGCCATTGGCCCTGG - Intronic
1132608339 16:802748-802770 CCTCCTCCTGCCCTTGGCCTTGG - Intergenic
1137237017 16:46624999-46625021 CCTGCTCTTGCCCTATGGCCAGG + Intergenic
1140626491 16:76801020-76801042 GCCTCTCTTGCCCTTTGCCCAGG + Intergenic
1142008156 16:87700229-87700251 ACTGTTCTTGCCTTTGGTCTTGG + Intronic
1142599051 17:1044173-1044195 CCGGCTCTTGCCCCTGCCCCCGG - Intronic
1143100025 17:4499627-4499649 ACTCCTCTATCCCTTGGCCCCGG - Intronic
1143444629 17:7000258-7000280 AAATCTCTTGCCCTTTGCCCCGG + Intronic
1143621192 17:8081021-8081043 ATGGCTCTGGCCCTTTGCCCTGG - Exonic
1145230242 17:21168656-21168678 ACTGCGTTTGGCCTTGGCACTGG + Intronic
1145995823 17:29104291-29104313 TCTTCTCTTTCCCTTGGGCCAGG - Intronic
1146133439 17:30297661-30297683 CCTGCTCTAGCCCATGGCTCTGG - Intergenic
1146500845 17:33363240-33363262 TCTGCTCTTCCCCCTGCCCCTGG - Intronic
1147335105 17:39723064-39723086 TATACTCTTGCCCTTGGCTCTGG - Intronic
1148073090 17:44920026-44920048 TCTGCTTGGGCCCTTGGCCCTGG + Intergenic
1152339000 17:79714199-79714221 TCTCCTCTTTCCCCTGGCCCCGG + Intergenic
1152804866 17:82350845-82350867 ACAGTTCTTGCCGATGGCCCAGG + Intergenic
1154135198 18:11771661-11771683 ACTGCACTTGCCACTGTCCCTGG - Intronic
1157584451 18:48792217-48792239 ACTGCTCTTTCTCTTTGACCAGG - Intronic
1157729835 18:49993939-49993961 TCTAATCTTGCCCTTGGTCCCGG + Intronic
1157751872 18:50186464-50186486 ACTGCTCTTGCTCCTTCCCCAGG + Intronic
1160657606 19:281585-281607 CCTGCTCATGCCCATGTCCCTGG - Intronic
1160668606 19:345010-345032 CCTGATCTTGGCCTTGGCCTTGG + Intergenic
1161592738 19:5136076-5136098 CCTGCCCTTGACCTTGGCCCAGG + Intronic
1162877749 19:13633359-13633381 AATGCCTTTGCCATTGGCCCAGG + Intergenic
1162924553 19:13923656-13923678 CCTGCTCATGTCCCTGGCCCTGG - Intronic
1163297294 19:16420734-16420756 ACTCCTCTTGCCACTGGCCAGGG - Intronic
1163599938 19:18242968-18242990 ACTGCTCTAGCCTCTGCCCCAGG - Intronic
1166328429 19:42065322-42065344 TCTGGCCTTGGCCTTGGCCCGGG - Exonic
1166567541 19:43774421-43774443 GCAGCGCTTCCCCTTGGCCCAGG + Exonic
1166827613 19:45619173-45619195 ACAGCTCTTCCACATGGCCCTGG + Exonic
1166878887 19:45914745-45914767 GCTGCTCTTGCCCTTGCCCACGG - Exonic
1167095951 19:47375252-47375274 CCTCCTCTTGCCCCTGGCCCCGG + Intronic
1168069314 19:53941118-53941140 ATTTCTCTTGCCCCTGCCCCAGG + Intronic
925165860 2:1715214-1715236 ACTGTCCTTGCCCTTAACCCCGG - Intronic
926133681 2:10321625-10321647 TCTCCTCGTGCCCTAGGCCCTGG + Intronic
927702739 2:25278141-25278163 ACTGCTCCTGGCCCAGGCCCAGG + Intronic
929573250 2:43036648-43036670 AGTGATCTAGCCCTTGGTCCAGG - Intergenic
931103178 2:59025362-59025384 ACTGCTCTGGGCCATGGCACTGG - Intergenic
932563313 2:72890628-72890650 ACTGCACTTGGCCTAGGCTCAGG + Intronic
932605478 2:73162955-73162977 ACGGCTCCTGCCCATGGCCAAGG - Intergenic
933651379 2:84852806-84852828 TCTGGTCTTGCCATTGGCCCAGG - Intronic
935264318 2:101381729-101381751 GATGCTCTTGCCCTTGGCCCCGG + Intronic
935367849 2:102313725-102313747 ACTGCATTTGCCCTTGGACATGG - Intronic
935496476 2:103788584-103788606 ACTCCCCTTGGCCCTGGCCCTGG + Intergenic
935951660 2:108335290-108335312 ACTAGTCCTGGCCTTGGCCCTGG + Intergenic
936095246 2:109526247-109526269 CCTGCTGTTGCCTGTGGCCCTGG + Intergenic
936716546 2:115193501-115193523 ACAGCTATTGTCCATGGCCCTGG - Intronic
937260938 2:120586559-120586581 ACTCCTCTTTCCATGGGCCCGGG - Intergenic
937972204 2:127559518-127559540 ACAGCTCTTGCACTTGGGCTAGG + Intronic
938039296 2:128062639-128062661 CCTGCTCTGGCACCTGGCCCAGG + Intergenic
939284291 2:140109171-140109193 GCTGCTTGTGCCCTTGTCCCTGG - Intergenic
939850135 2:147294433-147294455 ACTGCTTTTGCCCTTTGGCAGGG + Intergenic
941169931 2:162124444-162124466 ACTGCACTGGCCACTGGCCCAGG - Intergenic
941772694 2:169361853-169361875 AGTGCTCTGGCCCGCGGCCCTGG + Intronic
942648621 2:178143522-178143544 ACTCTGCTTGCCCTTTGCCCTGG - Intergenic
944471112 2:200054928-200054950 ATTCCTGTTGCCCTTGGGCCAGG + Intergenic
945241715 2:207682146-207682168 TCTCCTCTTGCCCCTGGCCCAGG + Intergenic
945611523 2:212010579-212010601 TCTGCTTTTGCCCTTTGCCTTGG - Intronic
945859332 2:215103015-215103037 ACTGCACTTGCCTTGGTCCCAGG + Intronic
946863559 2:224022810-224022832 CCTGGTCCTGCCCTTGGCACAGG - Intronic
947589742 2:231378828-231378850 ACTCTTCTTGCCTTTGGCCGAGG - Intergenic
947955080 2:234182686-234182708 ATTCCTCTTGCCCTTGGTCTAGG + Intergenic
948457565 2:238113877-238113899 ACTGCTCTTGCCCTGAGCCTGGG - Intronic
1168953041 20:1815501-1815523 TCTGCTCTTCCCCTTTGCCTGGG + Intergenic
1169466276 20:5843375-5843397 ACTTGTCTTGGCCTTGGCTCTGG - Intronic
1169657934 20:7946037-7946059 ACTCTTCTTGACATTGGCCCTGG - Intergenic
1170029881 20:11933526-11933548 CCTTCTCTTGCCAATGGCCCTGG + Intergenic
1173115810 20:40241689-40241711 AGTGCTCTGGGCCCTGGCCCAGG + Intergenic
1173338727 20:42135368-42135390 GCTGCTGATGCCATTGGCCCAGG - Intronic
1173598248 20:44274130-44274152 ACTGTTCTTGTCCTTGTCCAAGG + Intronic
1173796664 20:45865617-45865639 ACTGCCTTTGCCCTTGACCTTGG + Intronic
1175747494 20:61468316-61468338 CTGGCTCTTGCCTTTGGCCCTGG - Intronic
1175824791 20:61931008-61931030 TCTGCTGTTGACCGTGGCCCCGG - Intronic
1175831522 20:61967490-61967512 ACTGCTCCTGACCCTGGTCCAGG - Intronic
1175889548 20:62310222-62310244 ACTGATCTTCCACTTGGGCCAGG - Exonic
1178914162 21:36697820-36697842 ACTGCTCTCGCCACTGGCCCGGG - Intergenic
1179888846 21:44325895-44325917 ACTGGCGTTGGCCTTGGCCCAGG + Intronic
1181734036 22:24868220-24868242 ACTGCTCCTGACCTTTGCCCAGG + Intronic
1181902856 22:26169907-26169929 ACCGCACGTCCCCTTGGCCCGGG + Intronic
1182298820 22:29326918-29326940 ACAGCTCGAGCCCTTGACCCTGG + Intergenic
1182576647 22:31277253-31277275 GCTCCTCGTGCCCCTGGCCCAGG + Exonic
1182620390 22:31615431-31615453 ACTGCTGTGGCCCTTGGACCTGG - Intronic
1184284278 22:43459847-43459869 ACTGCTCTTTCCCTTGTCTAAGG + Intronic
1184484081 22:44765671-44765693 GCTGCTCCTGTCCTTGGCCCGGG - Intronic
1184580328 22:45412956-45412978 ACTGCTCTTGCCCTTGGCCCTGG - Intronic
950440344 3:13006764-13006786 ACTTCTCATGCCCCTGCCCCTGG - Intronic
951635151 3:24766246-24766268 TCTGCTCTTCCCCTTGACTCTGG + Intergenic
952543665 3:34395757-34395779 ACTGCTGTTGCCATTGCCACTGG - Intergenic
953538122 3:43791261-43791283 GCTGCTCTTCTCCTTTGCCCTGG + Intergenic
954791379 3:53135892-53135914 ACTGCTCTGACCTCTGGCCCTGG - Intergenic
955996405 3:64685017-64685039 AGAGCTCTTGCCCTAGGTCCTGG + Intronic
956701291 3:71961354-71961376 AAAGCCCATGCCCTTGGCCCTGG + Intergenic
959725002 3:109533134-109533156 AGTGCTCTTCCCTTTGGCCCAGG + Intergenic
960537504 3:118829452-118829474 ACTGCCCTTGCCCAGGGCTCAGG - Intergenic
960858790 3:122130221-122130243 ACTGTTCTGGACATTGGCCCTGG + Intergenic
961391037 3:126552537-126552559 CCTGTTCTTGTCCTTGCCCCAGG - Intronic
961405233 3:126673616-126673638 CCTGCTCTTGCCCTTAGAGCTGG + Intergenic
961484341 3:127206775-127206797 CCTGCCCCTGCCCCTGGCCCTGG - Intergenic
961653885 3:128430931-128430953 ACTGCTCCTGCCCCTGCCCCAGG - Intergenic
961750135 3:129089696-129089718 CCTGCTCTTGCCCTATGGCCAGG + Exonic
961794746 3:129401540-129401562 GCTGCACTGGCCCCTGGCCCAGG + Exonic
962812645 3:138972610-138972632 AAGGCTCTTGCCCTTGCCACAGG + Intergenic
966151904 3:176875030-176875052 ACTGCTGTTGCCTTTGGGCTTGG - Intergenic
966729019 3:183135063-183135085 TCTGCTCTTGGCCCTTGCCCAGG + Intronic
968333261 3:197890069-197890091 AGTGCTTTTGCCCTTGGCCCAGG - Intronic
968609947 4:1552391-1552413 ACTGCACCTGCCCTGGGCCTGGG - Intergenic
968660672 4:1797562-1797584 CCGGCTGTTGCCCTTGGGCCAGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969078370 4:4598867-4598889 TCTGCACCTGCCCTTGGCCTTGG - Intergenic
974880281 4:67748064-67748086 TCCTCTCTTGCCCCTGGCCCTGG + Intronic
975473268 4:74794262-74794284 ACTGCTCCTGGCCCTTGCCCTGG - Exonic
976633585 4:87265079-87265101 TCTGCTCTGGCCCTTGGTCCTGG - Intergenic
977032780 4:91907908-91907930 TCTTCTCTTGCCCTTGGACTTGG - Intergenic
980923774 4:139114795-139114817 GCTCCTCGTGCCCCTGGCCCAGG - Intronic
981442719 4:144801115-144801137 TCTTCTCCTGCCCTTGGACCAGG + Intergenic
982428551 4:155295938-155295960 TCTTCTCCTGCCCTTGGACCAGG + Intergenic
983423045 4:167545341-167545363 ACTCTTCTGGACCTTGGCCCAGG - Intergenic
989536159 5:42565889-42565911 GCTGCTGTTGACCTTGGCACTGG + Exonic
992099975 5:73397658-73397680 ACTGCTCTGACTCTTGGGCCAGG + Intergenic
992948365 5:81832158-81832180 TCTTCTCTTGCCCTTGGACCGGG - Intergenic
997402309 5:133612334-133612356 CCTGGTCTTCCCCTCGGCCCCGG - Exonic
997646227 5:135483807-135483829 GTTGCTCTTCCCCTGGGCCCTGG - Intergenic
998370594 5:141658479-141658501 TCTGCTCTTGCCCTGACCCCAGG - Exonic
1001760591 5:174204913-174204935 TCTGCTCATGCCCTTGGCAGGGG + Intronic
1002293565 5:178215522-178215544 TCTGCTCTTGCCACTGGCCTTGG - Intronic
1002331197 5:178442129-178442151 TCTCCTCTTCCCCTTGGCCAAGG + Intronic
1002394285 5:178941173-178941195 ACTGCGCTTGCGCGTTGCCCTGG - Exonic
1002835458 6:861560-861582 GCTGCTCTTGGCCTAGGCACAGG + Intergenic
1002917480 6:1540990-1541012 ACTGCCCTTGCCCCAGCCCCCGG + Intergenic
1003188197 6:3850578-3850600 CCCGCTCTTGCCCCTCGCCCTGG - Exonic
1003276279 6:4655923-4655945 GCTGCTCTTGCTCTAAGCCCAGG - Intergenic
1004722092 6:18276793-18276815 ACTGCTCTTGCCCTGAGGCAGGG + Intergenic
1005013475 6:21357284-21357306 CCTGCTATTGCCCTTGCCACAGG - Intergenic
1009456367 6:63861354-63861376 ACTGCCATTGCCCTTGTCCTAGG + Intronic
1009852583 6:69216446-69216468 ACTCCTGTTGCCATCGGCCCAGG + Intronic
1012741388 6:103020065-103020087 TCTGCTCTTTCCTTTGGGCCTGG - Intergenic
1017514371 6:155142530-155142552 GCTGCTCTGCCCCTTTGCCCTGG + Intronic
1018203677 6:161417081-161417103 TCTCTTCTTGCTCTTGGCCCAGG - Intronic
1018865395 6:167743365-167743387 ACAGCTCTTGTCCTTTACCCAGG - Intergenic
1019348052 7:540056-540078 AATCCTCTTGTCCTTGGCTCAGG - Intergenic
1019387232 7:764173-764195 GCAGCTCTTCCACTTGGCCCGGG + Intronic
1019636031 7:2076175-2076197 GCTGGTTTTGCCCTGGGCCCGGG - Intronic
1020024255 7:4887581-4887603 ACTGCTCTCTTCCTTGGCCTTGG + Intergenic
1020260549 7:6528565-6528587 CCTCATCTTGCCCTTGGCCCTGG - Intronic
1023016211 7:35971012-35971034 GCTCCTCGTGCCCCTGGCCCGGG - Intergenic
1023648650 7:42345429-42345451 ACTGCAATTGTCCTTGGCACAGG + Intergenic
1023747800 7:43338172-43338194 GCTGCTCTTGTCGTTGGCCTGGG + Intronic
1023814506 7:43939234-43939256 ACTGCCCTTCCCCTTGGCAGAGG - Intronic
1025753467 7:64312835-64312857 ACTGACCTTGTCCTTGACCCTGG - Intronic
1026232385 7:68496564-68496586 TGTACTCTTGTCCTTGGCCCTGG + Intergenic
1026367316 7:69661615-69661637 ACTTCTCTTTCCCTTGGTCATGG - Intronic
1030544268 7:110872848-110872870 ACTGCTCATGCTCATGGCCATGG + Intronic
1031064593 7:117091251-117091273 CCTCTCCTTGCCCTTGGCCCTGG - Intronic
1034077095 7:148242698-148242720 ACTGCTCTGTCCCTGAGCCCTGG + Intronic
1037882786 8:22581012-22581034 TCTCCTCTTGACCTGGGCCCAGG + Intronic
1039412341 8:37365512-37365534 ACAGCTCCTGCTCTAGGCCCTGG - Intergenic
1039890807 8:41684071-41684093 ACTGCACTAGACCTTGGGCCAGG + Intronic
1041027643 8:53703485-53703507 ACTGCACCTGCCCTGGGCCTTGG - Intergenic
1044748463 8:95394116-95394138 GCTGCGCTGGCCCTTGGCACTGG - Intergenic
1045090014 8:98731867-98731889 TCTGGTCTTGCCCTTGGGACTGG - Intronic
1046738996 8:117808973-117808995 ACTTCTATTGCCCTTGGACTGGG + Intronic
1047541253 8:125768646-125768668 GGTTCTCTTGCCCTTTGCCCGGG + Intergenic
1048313255 8:133342558-133342580 TCTTCTCTTGCCCTTGGACCGGG + Intergenic
1049277703 8:141728199-141728221 AGTGCTCTTGCTCCTGGCCCAGG + Intergenic
1052579235 9:30332684-30332706 ATTGCTTTTTCCCTTGGCCATGG + Intergenic
1055127387 9:72734294-72734316 ACTGCTCTTGCTATTTGCCATGG + Intronic
1057466751 9:95321186-95321208 AATGTTCTTGCTCCTGGCCCAGG + Intergenic
1057704658 9:97388246-97388268 ACTGACCTTGCCCTCGACCCTGG - Intergenic
1057854666 9:98593421-98593443 CCTGCTCCTGCCATTGTCCCTGG - Intronic
1058419745 9:104822383-104822405 TGTGCTCCTTCCCTTGGCCCAGG + Intronic
1060751636 9:126173598-126173620 AAGGCTCTTGACCTTGGCCTTGG + Intergenic
1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG + Intergenic
1060825699 9:126686659-126686681 GCTGCCCTTACCCTGGGCCCTGG - Intronic
1061423367 9:130484116-130484138 ACTGCTTCTCACCTTGGCCCTGG + Intronic
1061494349 9:130963144-130963166 ACGGCCCTTGCCCTAGGCCTGGG - Intergenic
1061539732 9:131271680-131271702 ACTGCCCCTGACCTTGGCCTTGG + Intronic
1061584840 9:131558866-131558888 ACAGATGTTGCCATTGGCCCTGG - Intergenic
1061729210 9:132600493-132600515 ACTGTGCCTGTCCTTGGCCCAGG - Intronic
1061907715 9:133707416-133707438 ACTGCCCTGGCCCTTTGGCCTGG - Intronic
1062303969 9:135891455-135891477 ACAGCTTTTGCCTGTGGCCCCGG - Intronic
1188444651 X:30243644-30243666 ACTGTCATTGACCTTGGCCCAGG - Exonic
1189733355 X:44045113-44045135 TCACCTCTTGCCCTGGGCCCAGG - Intergenic
1190163375 X:48050742-48050764 ACTCTTCTGGCCCTTGGCCTAGG - Intronic
1193583654 X:83294506-83294528 ACTCCTACTGCCCTTGGCCTCGG + Intergenic
1196131154 X:112157983-112158005 ACTGCTCTGCCCCCTGTCCCTGG + Intergenic
1196391822 X:115215346-115215368 ACTGTTTATGTCCTTGGCCCAGG - Intronic
1197134423 X:123044597-123044619 ACTGCTCTCCCCCTTGTTCCGGG + Intergenic
1197287049 X:124607837-124607859 ACTGCTCCTGTCCTGGTCCCAGG - Intronic
1201525993 Y:14935208-14935230 GCTGCTTCTGCCCTTGGCCTAGG - Intergenic