ID: 1184585841

View in Genome Browser
Species Human (GRCh38)
Location 22:45447616-45447638
Sequence ATGGAGAAGCTGGAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184585841_1184585849 -2 Left 1184585841 22:45447616-45447638 CCCTTCTCCTCCAGCTTCTCCAT No data
Right 1184585849 22:45447637-45447659 ATGGATCTCTTGGGAATCTGTGG No data
1184585841_1184585851 28 Left 1184585841 22:45447616-45447638 CCCTTCTCCTCCAGCTTCTCCAT No data
Right 1184585851 22:45447667-45447689 TCAAGAAATCCTGTATTGGCCGG No data
1184585841_1184585850 24 Left 1184585841 22:45447616-45447638 CCCTTCTCCTCCAGCTTCTCCAT No data
Right 1184585850 22:45447663-45447685 CAACTCAAGAAATCCTGTATTGG No data
1184585841_1184585852 29 Left 1184585841 22:45447616-45447638 CCCTTCTCCTCCAGCTTCTCCAT No data
Right 1184585852 22:45447668-45447690 CAAGAAATCCTGTATTGGCCGGG No data
1184585841_1184585853 30 Left 1184585841 22:45447616-45447638 CCCTTCTCCTCCAGCTTCTCCAT No data
Right 1184585853 22:45447669-45447691 AAGAAATCCTGTATTGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184585841 Original CRISPR ATGGAGAAGCTGGAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr