ID: 1184586075

View in Genome Browser
Species Human (GRCh38)
Location 22:45448941-45448963
Sequence GGCCCCTGGAACCTCCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184586069_1184586075 12 Left 1184586069 22:45448906-45448928 CCAAGTCACACCTGGTGCAGTCA No data
Right 1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG No data
1184586066_1184586075 21 Left 1184586066 22:45448897-45448919 CCAGGGTTCCCAAGTCACACCTG No data
Right 1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG No data
1184586070_1184586075 2 Left 1184586070 22:45448916-45448938 CCTGGTGCAGTCACAATTGCACT No data
Right 1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG No data
1184586064_1184586075 29 Left 1184586064 22:45448889-45448911 CCTCCTCGCCAGGGTTCCCAAGT No data
Right 1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG No data
1184586068_1184586075 13 Left 1184586068 22:45448905-45448927 CCCAAGTCACACCTGGTGCAGTC No data
Right 1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG No data
1184586065_1184586075 26 Left 1184586065 22:45448892-45448914 CCTCGCCAGGGTTCCCAAGTCAC No data
Right 1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184586075 Original CRISPR GGCCCCTGGAACCTCCTGAG GGG Intergenic
No off target data available for this crispr