ID: 1184586637

View in Genome Browser
Species Human (GRCh38)
Location 22:45452519-45452541
Sequence CATAGTGGACAGAAGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184586637_1184586645 -1 Left 1184586637 22:45452519-45452541 CCCCCTTCCTTCTGTCCACTATG No data
Right 1184586645 22:45452541-45452563 GTCCTGAACAATGGAACTGAGGG No data
1184586637_1184586647 4 Left 1184586637 22:45452519-45452541 CCCCCTTCCTTCTGTCCACTATG No data
Right 1184586647 22:45452546-45452568 GAACAATGGAACTGAGGGTCTGG No data
1184586637_1184586649 11 Left 1184586637 22:45452519-45452541 CCCCCTTCCTTCTGTCCACTATG No data
Right 1184586649 22:45452553-45452575 GGAACTGAGGGTCTGGTGGCAGG No data
1184586637_1184586648 7 Left 1184586637 22:45452519-45452541 CCCCCTTCCTTCTGTCCACTATG No data
Right 1184586648 22:45452549-45452571 CAATGGAACTGAGGGTCTGGTGG No data
1184586637_1184586650 17 Left 1184586637 22:45452519-45452541 CCCCCTTCCTTCTGTCCACTATG No data
Right 1184586650 22:45452559-45452581 GAGGGTCTGGTGGCAGGATCTGG No data
1184586637_1184586642 -10 Left 1184586637 22:45452519-45452541 CCCCCTTCCTTCTGTCCACTATG No data
Right 1184586642 22:45452532-45452554 GTCCACTATGTCCTGAACAATGG No data
1184586637_1184586651 29 Left 1184586637 22:45452519-45452541 CCCCCTTCCTTCTGTCCACTATG No data
Right 1184586651 22:45452571-45452593 GCAGGATCTGGTACCTGTGCTGG No data
1184586637_1184586652 30 Left 1184586637 22:45452519-45452541 CCCCCTTCCTTCTGTCCACTATG No data
Right 1184586652 22:45452572-45452594 CAGGATCTGGTACCTGTGCTGGG No data
1184586637_1184586644 -2 Left 1184586637 22:45452519-45452541 CCCCCTTCCTTCTGTCCACTATG No data
Right 1184586644 22:45452540-45452562 TGTCCTGAACAATGGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184586637 Original CRISPR CATAGTGGACAGAAGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr