ID: 1184587027

View in Genome Browser
Species Human (GRCh38)
Location 22:45454812-45454834
Sequence TCCAGGTGGCCAGCAATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184587027_1184587032 -3 Left 1184587027 22:45454812-45454834 CCAGCCATTGCTGGCCACCTGGA No data
Right 1184587032 22:45454832-45454854 GGATTCAAGAAAGAGCCAGGTGG No data
1184587027_1184587034 6 Left 1184587027 22:45454812-45454834 CCAGCCATTGCTGGCCACCTGGA No data
Right 1184587034 22:45454841-45454863 AAAGAGCCAGGTGGAAATTTGGG No data
1184587027_1184587031 -6 Left 1184587027 22:45454812-45454834 CCAGCCATTGCTGGCCACCTGGA No data
Right 1184587031 22:45454829-45454851 CCTGGATTCAAGAAAGAGCCAGG No data
1184587027_1184587036 29 Left 1184587027 22:45454812-45454834 CCAGCCATTGCTGGCCACCTGGA No data
Right 1184587036 22:45454864-45454886 AAGAAGCAGTATTTTCTTCCAGG No data
1184587027_1184587033 5 Left 1184587027 22:45454812-45454834 CCAGCCATTGCTGGCCACCTGGA No data
Right 1184587033 22:45454840-45454862 GAAAGAGCCAGGTGGAAATTTGG No data
1184587027_1184587037 30 Left 1184587027 22:45454812-45454834 CCAGCCATTGCTGGCCACCTGGA No data
Right 1184587037 22:45454865-45454887 AGAAGCAGTATTTTCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184587027 Original CRISPR TCCAGGTGGCCAGCAATGGC TGG (reversed) Intergenic
No off target data available for this crispr