ID: 1184592113

View in Genome Browser
Species Human (GRCh38)
Location 22:45491765-45491787
Sequence CCTGTAGTGGAAAGAAAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184592103_1184592113 23 Left 1184592103 22:45491719-45491741 CCCCAGATTTAAGGGAAGCTGGT No data
Right 1184592113 22:45491765-45491787 CCTGTAGTGGAAAGAAAGCCGGG No data
1184592104_1184592113 22 Left 1184592104 22:45491720-45491742 CCCAGATTTAAGGGAAGCTGGTG No data
Right 1184592113 22:45491765-45491787 CCTGTAGTGGAAAGAAAGCCGGG No data
1184592105_1184592113 21 Left 1184592105 22:45491721-45491743 CCAGATTTAAGGGAAGCTGGTGG No data
Right 1184592113 22:45491765-45491787 CCTGTAGTGGAAAGAAAGCCGGG No data
1184592101_1184592113 29 Left 1184592101 22:45491713-45491735 CCAGCACCCCAGATTTAAGGGAA No data
Right 1184592113 22:45491765-45491787 CCTGTAGTGGAAAGAAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184592113 Original CRISPR CCTGTAGTGGAAAGAAAGCC GGG Intergenic
No off target data available for this crispr