ID: 1184592855

View in Genome Browser
Species Human (GRCh38)
Location 22:45496796-45496818
Sequence CCCTTTGATCCCTGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184592855_1184592865 -7 Left 1184592855 22:45496796-45496818 CCCAGGACCCAGGGATCAAAGGG No data
Right 1184592865 22:45496812-45496834 CAAAGGGTGGGGGGCCTCCCTGG No data
1184592855_1184592869 12 Left 1184592855 22:45496796-45496818 CCCAGGACCCAGGGATCAAAGGG No data
Right 1184592869 22:45496831-45496853 CTGGCCCCTACATCCCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184592855 Original CRISPR CCCTTTGATCCCTGGGTCCT GGG (reversed) Intergenic
No off target data available for this crispr