ID: 1184592857

View in Genome Browser
Species Human (GRCh38)
Location 22:45496797-45496819
Sequence ACCCTTTGATCCCTGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184592857_1184592865 -8 Left 1184592857 22:45496797-45496819 CCAGGACCCAGGGATCAAAGGGT No data
Right 1184592865 22:45496812-45496834 CAAAGGGTGGGGGGCCTCCCTGG No data
1184592857_1184592869 11 Left 1184592857 22:45496797-45496819 CCAGGACCCAGGGATCAAAGGGT No data
Right 1184592869 22:45496831-45496853 CTGGCCCCTACATCCCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184592857 Original CRISPR ACCCTTTGATCCCTGGGTCC TGG (reversed) Intergenic
No off target data available for this crispr