ID: 1184592862

View in Genome Browser
Species Human (GRCh38)
Location 22:45496803-45496825
Sequence CCCCCCACCCTTTGATCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184592862_1184592869 5 Left 1184592862 22:45496803-45496825 CCCAGGGATCAAAGGGTGGGGGG No data
Right 1184592869 22:45496831-45496853 CTGGCCCCTACATCCCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184592862 Original CRISPR CCCCCCACCCTTTGATCCCT GGG (reversed) Intergenic