ID: 1184592864 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:45496804-45496826 |
| Sequence | GCCCCCCACCCTTTGATCCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1184592864_1184592869 | 4 | Left | 1184592864 | 22:45496804-45496826 | CCAGGGATCAAAGGGTGGGGGGC | No data | ||
| Right | 1184592869 | 22:45496831-45496853 | CTGGCCCCTACATCCCCTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1184592864 | Original CRISPR | GCCCCCCACCCTTTGATCCC TGG (reversed) | Intergenic | ||