ID: 1184592865

View in Genome Browser
Species Human (GRCh38)
Location 22:45496812-45496834
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184592857_1184592865 -8 Left 1184592857 22:45496797-45496819 CCAGGACCCAGGGATCAAAGGGT No data
Right 1184592865 22:45496812-45496834 CAAAGGGTGGGGGGCCTCCCTGG No data
1184592855_1184592865 -7 Left 1184592855 22:45496796-45496818 CCCAGGACCCAGGGATCAAAGGG No data
Right 1184592865 22:45496812-45496834 CAAAGGGTGGGGGGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184592865 Original CRISPR CAAAGGGTGGGGGGCCTCCC TGG Intergenic