ID: 1184592869

View in Genome Browser
Species Human (GRCh38)
Location 22:45496831-45496853
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184592855_1184592869 12 Left 1184592855 22:45496796-45496818 CCCAGGACCCAGGGATCAAAGGG No data
Right 1184592869 22:45496831-45496853 CTGGCCCCTACATCCCCTAATGG No data
1184592864_1184592869 4 Left 1184592864 22:45496804-45496826 CCAGGGATCAAAGGGTGGGGGGC No data
Right 1184592869 22:45496831-45496853 CTGGCCCCTACATCCCCTAATGG No data
1184592862_1184592869 5 Left 1184592862 22:45496803-45496825 CCCAGGGATCAAAGGGTGGGGGG No data
Right 1184592869 22:45496831-45496853 CTGGCCCCTACATCCCCTAATGG No data
1184592857_1184592869 11 Left 1184592857 22:45496797-45496819 CCAGGACCCAGGGATCAAAGGGT No data
Right 1184592869 22:45496831-45496853 CTGGCCCCTACATCCCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184592869 Original CRISPR CTGGCCCCTACATCCCCTAA TGG Intergenic