ID: 1184593739

View in Genome Browser
Species Human (GRCh38)
Location 22:45502508-45502530
Sequence GTCGGAGGCCCGGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184593739_1184593757 18 Left 1184593739 22:45502508-45502530 CCCCCAGCAGCCGGGCCTCCGAC No data
Right 1184593757 22:45502549-45502571 CTCCTCCGCGCGGAGTCGGGCGG No data
1184593739_1184593758 19 Left 1184593739 22:45502508-45502530 CCCCCAGCAGCCGGGCCTCCGAC No data
Right 1184593758 22:45502550-45502572 TCCTCCGCGCGGAGTCGGGCGGG No data
1184593739_1184593756 15 Left 1184593739 22:45502508-45502530 CCCCCAGCAGCCGGGCCTCCGAC No data
Right 1184593756 22:45502546-45502568 CCGCTCCTCCGCGCGGAGTCGGG No data
1184593739_1184593754 14 Left 1184593739 22:45502508-45502530 CCCCCAGCAGCCGGGCCTCCGAC No data
Right 1184593754 22:45502545-45502567 CCCGCTCCTCCGCGCGGAGTCGG No data
1184593739_1184593751 8 Left 1184593739 22:45502508-45502530 CCCCCAGCAGCCGGGCCTCCGAC No data
Right 1184593751 22:45502539-45502561 CGGGTCCCCGCTCCTCCGCGCGG No data
1184593739_1184593760 20 Left 1184593739 22:45502508-45502530 CCCCCAGCAGCCGGGCCTCCGAC No data
Right 1184593760 22:45502551-45502573 CCTCCGCGCGGAGTCGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184593739 Original CRISPR GTCGGAGGCCCGGCTGCTGG GGG (reversed) Intronic