ID: 1184597520

View in Genome Browser
Species Human (GRCh38)
Location 22:45523218-45523240
Sequence GGCGGCCAGGGTGGCTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184597512_1184597520 3 Left 1184597512 22:45523192-45523214 CCCAGAGGAGAGGGTGTGTACAG 0: 1
1: 0
2: 3
3: 18
4: 203
Right 1184597520 22:45523218-45523240 GGCGGCCAGGGTGGCTGGAGTGG No data
1184597509_1184597520 15 Left 1184597509 22:45523180-45523202 CCAGCGCAAGAGCCCAGAGGAGA 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1184597520 22:45523218-45523240 GGCGGCCAGGGTGGCTGGAGTGG No data
1184597513_1184597520 2 Left 1184597513 22:45523193-45523215 CCAGAGGAGAGGGTGTGTACAGC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1184597520 22:45523218-45523240 GGCGGCCAGGGTGGCTGGAGTGG No data
1184597507_1184597520 27 Left 1184597507 22:45523168-45523190 CCGAGGGAACAGCCAGCGCAAGA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1184597520 22:45523218-45523240 GGCGGCCAGGGTGGCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184597520 Original CRISPR GGCGGCCAGGGTGGCTGGAG TGG Intronic