ID: 1184598751

View in Genome Browser
Species Human (GRCh38)
Location 22:45530025-45530047
Sequence TGTAGGGCCCCTGGTCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184598745_1184598751 14 Left 1184598745 22:45529988-45530010 CCTTTCACTTCTTGTTCTTAGGT 0: 1
1: 0
2: 1
3: 19
4: 289
Right 1184598751 22:45530025-45530047 TGTAGGGCCCCTGGTCACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 163
1184598743_1184598751 30 Left 1184598743 22:45529972-45529994 CCTGGGTGACACGGAACCTTTCA 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1184598751 22:45530025-45530047 TGTAGGGCCCCTGGTCACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184598751 Original CRISPR TGTAGGGCCCCTGGTCACAG AGG Intronic
900740220 1:4326625-4326647 TGTGGGGTCCCTGCCCACAGAGG - Intergenic
902383426 1:16063382-16063404 CTTAGGGCCCCTGGTCCCACAGG + Intronic
902436217 1:16399483-16399505 TGCAGGGCACCTGGGCATAGGGG + Exonic
902482465 1:16719000-16719022 TGCAGGGCCCCTGGCCACCAGGG - Intergenic
903995900 1:27305385-27305407 TGCAGAGGCCCTGGTCACAAGGG + Intronic
905950515 1:41946785-41946807 TGTAGGGCCTCGGGTCTAAGAGG - Intronic
908338047 1:63147616-63147638 TTTCTGGCCCCTGGTCAGAGAGG - Intergenic
909599008 1:77441760-77441782 TGCAGTGGCACTGGTCACAGAGG + Intronic
912968742 1:114260542-114260564 TGCAGGGTCCCTGGGCTCAGTGG + Intergenic
913551830 1:119923926-119923948 TGTTGCACCCCTGGTCACAGTGG + Exonic
914972865 1:152326870-152326892 TGTAGGGCCCAAGGACACAAAGG - Intergenic
915401401 1:155624631-155624653 TGTTGGGCTTCTGGTCAGAGGGG + Intergenic
917740923 1:177961455-177961477 TGTAGGTCACCTGGGCAGAGAGG - Intronic
920426364 1:205879717-205879739 TTTTGGGCCCCTGGGCAGAGAGG + Intergenic
922348719 1:224718424-224718446 TGTAGGGCCCAGGGGCACAGAGG + Intronic
922748578 1:228060428-228060450 GGTAGGGCCCCTGGTCAGGTGGG - Exonic
924396618 1:243628049-243628071 TGTCTGGCCCATGGTCCCAGTGG - Intronic
1063392736 10:5660847-5660869 TGGAGGGGCTCTGGTCTCAGAGG - Intronic
1065872371 10:29966494-29966516 TGTGGGGCCCCTGGGCTCAGAGG - Intergenic
1073045847 10:100637803-100637825 GGCAGGGCCTCTGGTCACACGGG - Intergenic
1075080121 10:119378042-119378064 AGTAGGGAACCTGGTCTCAGCGG - Intronic
1075411013 10:122228020-122228042 TGGAGGGCCCCAGATCACAGGGG + Intronic
1075415232 10:122258015-122258037 TCCAGGGCCCCAGGTCACAAAGG - Intergenic
1076230225 10:128814316-128814338 TGCAGCGCCCGTGCTCACAGAGG + Intergenic
1076809448 10:132879017-132879039 TGTCGGGCCCCAGCTAACAGAGG + Intronic
1077606483 11:3616127-3616149 TGCTGGGGCCCTGGTCAGAGCGG + Intergenic
1077882666 11:6363526-6363548 CCTAGGGGCCCTGGTCACTGAGG - Intergenic
1078861150 11:15248472-15248494 AGTAGGGCCCCTGATCTCTGGGG - Intergenic
1081690576 11:45075098-45075120 TGTTGGGCACCTGGGCTCAGGGG + Intergenic
1083453486 11:62762291-62762313 TGTGTGGTCCCTGGGCACAGGGG - Intronic
1084738124 11:71119091-71119113 TGTGGGGCGCGTGGTCAGAGAGG + Intronic
1090113654 11:123943149-123943171 TGTAGGGGCCCTGAGAACAGTGG + Exonic
1091141859 11:133242158-133242180 TGAAGGGACCCTGCACACAGGGG - Intronic
1091695873 12:2627742-2627764 TGAAGGGCCCTTGGAGACAGGGG - Intronic
1092150461 12:6244719-6244741 TGGAGGGCCCCAGGACATAGAGG + Intergenic
1092499456 12:9031138-9031160 TGTGAGGCCCCTGGTCACCCAGG + Intergenic
1097352470 12:58563151-58563173 TGTGGGGCCCGTGTTCACTGAGG - Intronic
1099861476 12:88229647-88229669 TGCAGGGCCCCTGATGGCAGAGG - Intergenic
1100282887 12:93135260-93135282 TGAAGAGCCCCTGGGCACAATGG + Intergenic
1101200173 12:102427509-102427531 TGCAGGGCCCCTGAGAACAGAGG - Intronic
1103915410 12:124373336-124373358 TGCAGGGGCCCCGGGCACAGTGG + Intronic
1103915421 12:124373381-124373403 TGCAGGGGCCCCGGGCACAGTGG + Intronic
1103915524 12:124373771-124373793 TGCAGGGGCCCTGGGCACGGTGG + Intronic
1103915535 12:124373816-124373838 TGCAGGGGCCCTGGGCACGGTGG + Intronic
1104843824 12:131836962-131836984 TGGAGGGGCCCTGGGGACAGGGG - Intronic
1106660210 13:31791517-31791539 TGTATGTTCCCTGGTCACATTGG - Intronic
1109886867 13:68555089-68555111 TGTAGGGCTTCTGGTCTCAAAGG - Intergenic
1112537511 13:100274710-100274732 TGTAGGGACACTAGTCACATTGG + Intronic
1113457882 13:110461915-110461937 TGTGGGGCCACTGGCCACAGTGG - Intronic
1113522992 13:110953807-110953829 TGTAGCCCACCTGGCCACAGAGG - Intergenic
1113947309 13:114051458-114051480 TGTGGGGCCTCTGGGCAGAGTGG - Intronic
1119400097 14:74357410-74357432 TGGAGGGCACGTGGTCGCAGCGG - Exonic
1119646017 14:76349098-76349120 TGTGACCCCCCTGGTCACAGAGG - Intronic
1120287198 14:82518968-82518990 TTTAGGGCCTATTGTCACAGGGG + Intergenic
1121839548 14:97121281-97121303 TGTAACCCCGCTGGTCACAGAGG + Intergenic
1122645391 14:103189999-103190021 TGCAAGGCCCCTGCTCCCAGGGG - Intergenic
1122649688 14:103219855-103219877 TGCAGGCCCCCTGCTCCCAGGGG + Intergenic
1124954881 15:34353835-34353857 TCTAGGGCCCCTGGCCTCTGAGG + Exonic
1125430779 15:39591253-39591275 TGTAGGGACAGTTGTCACAGCGG - Exonic
1128679451 15:69637302-69637324 TCTAGGGCCCTGGTTCACAGGGG + Intergenic
1129937415 15:79462474-79462496 AGATGGGCCCCTGGTCAGAGGGG - Intronic
1131067811 15:89445076-89445098 CGCAGGGCCCCTGCTCACGGTGG + Intergenic
1131384734 15:91994845-91994867 TGTAGGGCCCCTGCAGACATGGG + Intronic
1132046285 15:98565597-98565619 TGTGGCTCCCCTGGGCACAGAGG + Intergenic
1132849205 16:2016857-2016879 TGCAGGGCCTCTGGTCCCCGTGG + Intronic
1132863532 16:2082930-2082952 TGCAGGGCCCCTGGTCAACCTGG - Intronic
1133002094 16:2856881-2856903 TGAGGGGCCCCAGGACACAGTGG + Intronic
1133344231 16:5059607-5059629 TGCAGGGCCCATGGGCAAAGTGG - Intronic
1134622757 16:15701924-15701946 TGTTGGGCTTCTGGTCAAAGAGG + Intronic
1139922214 16:70467471-70467493 GGTAGTGCCCCTGGGGACAGTGG + Exonic
1142593667 17:1019254-1019276 CGGAGAGCCCCAGGTCACAGTGG + Intronic
1143264505 17:5626005-5626027 TGTGGGGCCACTGGGCCCAGGGG - Intergenic
1143382330 17:6504118-6504140 TCTAGGGCCCCAGGTCTCTGAGG + Intronic
1143855197 17:9843118-9843140 TGTAGATCCACTGGTGACAGGGG + Intronic
1145787772 17:27605201-27605223 TGAAGGGCCTCAGGTCACCGGGG + Intronic
1149039438 17:52170640-52170662 TGTAGGGGGCCTGGGCATAGTGG + Intergenic
1152301176 17:79495867-79495889 TGCAGGGTCCCTGCCCACAGGGG - Intronic
1153947878 18:10032767-10032789 TGAAGGGCGTCTGGACACAGCGG - Intergenic
1157919227 18:51698349-51698371 TGCAGGGCCCCTGATGGCAGAGG - Intergenic
1161179353 19:2869117-2869139 TTTAGGGGCACTGGTCACAATGG - Intronic
1161611695 19:5246696-5246718 GGCAGGGCCCCAGGTCACTGGGG - Intronic
1164088283 19:21923986-21924008 TGCATGGTCCCTGCTCACAGGGG + Intergenic
1164281379 19:23771860-23771882 TGTATGGGCCCTGCCCACAGAGG + Intronic
1164572215 19:29382682-29382704 TGGGGAGCCCCAGGTCACAGAGG - Intergenic
1165826024 19:38706250-38706272 TGTAGGGCCCGTGGCCAGGGAGG - Intronic
1166666268 19:44682432-44682454 TGTGAGGCCCCTGGGCAGAGGGG - Intronic
925278712 2:2668618-2668640 TGTGGGGCCCCTGGCCACTGAGG - Intergenic
932598008 2:73106337-73106359 TGTATGTCCCCTCCTCACAGAGG + Intronic
932769562 2:74492952-74492974 TGGAGGGCCCCAGGTGACAGAGG - Exonic
933168201 2:79097299-79097321 TGCAGGGCCCCTGATGGCAGAGG + Intergenic
934524591 2:95043775-95043797 TGCAGAGCCCAGGGTCACAGGGG - Intronic
935234471 2:101126954-101126976 TGGATGGCCCCAGGTCACAAGGG + Intronic
940554636 2:155207883-155207905 TATAGAGACCTTGGTCACAGAGG + Intergenic
942148484 2:173050593-173050615 GGTAGGGCCTCTGGTCTAAGGGG - Intronic
943058483 2:183012907-183012929 AGTAGGGGGCCTGGGCACAGTGG - Intronic
947650873 2:231785409-231785431 GGTAGTGCCCATTGTCACAGAGG - Intronic
1169186173 20:3619046-3619068 GGTGGGGCCGCTGGTCCCAGGGG + Intronic
1169198773 20:3697512-3697534 TGTGGGGGCCCTGGGCAGAGAGG + Intronic
1171229966 20:23476131-23476153 TGCAGGAGCCCTGGGCACAGGGG + Intergenic
1172345039 20:34191442-34191464 TGAAGGCCCTCTGGTCCCAGCGG + Intergenic
1175739163 20:61408564-61408586 TGTAGTGCCCCTGTGCTCAGAGG + Intronic
1176960636 21:15154999-15155021 TGGAGGGCACCTTTTCACAGGGG + Intergenic
1177160539 21:17542943-17542965 TGAAGGGCCTCTTTTCACAGAGG - Intronic
1178687115 21:34720700-34720722 TGTGTGGCCTCTGGTCACAAAGG + Intergenic
1180017196 21:45095211-45095233 TGCAGGGCTCCTGGTGACTGGGG - Intronic
1183513336 22:38248687-38248709 TGCAGGCCCCCTGGGGACAGCGG + Intronic
1184488590 22:44796156-44796178 TCTGGGACCCCTGGTCACTGAGG - Intronic
1184598751 22:45530025-45530047 TGTAGGGCCCCTGGTCACAGAGG + Intronic
950161475 3:10764225-10764247 TGGAGGGGCTGTGGTCACAGAGG + Intergenic
950606723 3:14087972-14087994 TGTAGAACCACTGGGCACAGTGG + Intergenic
956050532 3:65243454-65243476 TCTAGGGCCTCTTGCCACAGTGG - Intergenic
958612495 3:96445670-96445692 TATACGGCCCCTGTTCCCAGTGG - Intergenic
960590561 3:119361667-119361689 TGAAGGACCGCTGGGCACAGTGG - Intronic
962851417 3:139311022-139311044 TGTATGGCCCCAAATCACAGTGG - Intronic
963112847 3:141701088-141701110 TGCAGGGCCCCAGATGACAGAGG + Intergenic
967468321 3:189833480-189833502 TATAAGTCCCCAGGTCACAGGGG - Intronic
968222354 3:196948294-196948316 TGTAGGGCCCCACGTTACATGGG + Exonic
968581796 4:1398748-1398770 TGGAGGGCCCCTGGCCCCCGGGG + Intergenic
969076864 4:4586316-4586338 TCTAGGGCCACTGGACACACTGG - Intergenic
969611821 4:8231857-8231879 TGTGGGGCCCAGGCTCACAGAGG + Intronic
971344268 4:25797775-25797797 TGCTGGGCCCCGGGACACAGAGG + Intronic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
972672512 4:41227163-41227185 TGCAGGGCCCCTTTCCACAGTGG + Intergenic
980366427 4:131809776-131809798 TGTAAGGCCCCTGTTAACATAGG - Intergenic
981531824 4:145761330-145761352 TGTAGCTGCACTGGTCACAGTGG + Exonic
984251166 4:177336952-177336974 TGTAGAGCCCTTGTTCACATAGG + Intronic
988169951 5:27640562-27640584 TATAGGGCTCTTGGCCACAGAGG + Intergenic
988234314 5:28521136-28521158 GGTAGGGGCCTTGGTCACAACGG - Intergenic
990185000 5:53202654-53202676 TGCAGGGCCCCTGATAACGGAGG - Intergenic
992749578 5:79849810-79849832 TGGAGAGCCCCAGGGCACAGTGG - Intergenic
1001411824 5:171517781-171517803 TGGAGGGGCTCTGGACACAGTGG + Intergenic
1001486009 5:172120146-172120168 GGTGGCTCCCCTGGTCACAGGGG - Intronic
1004480954 6:16018899-16018921 TATAGGGCCTTTGGGCACAGTGG - Intergenic
1007637749 6:43309534-43309556 TGTAGGGTGGCTGGACACAGTGG + Intronic
1010057569 6:71584680-71584702 TGGAGCGACCCTGGTCCCAGAGG - Intergenic
1014685124 6:124487805-124487827 TGTATTGCCCATGGTCAGAGAGG + Intronic
1014991701 6:128088088-128088110 TGTAGCCCCGCTGGGCACAGTGG + Intronic
1016292283 6:142538797-142538819 TGCAGGGCCCCTGATGGCAGAGG - Intergenic
1017863074 6:158417204-158417226 TAGAGGGCCCCTGCTCACAGAGG - Intronic
1018755946 6:166849912-166849934 TGGAGGCCCCGTGGGCACAGCGG - Intronic
1019710602 7:2516613-2516635 GGTAGGGCCCCTGGTCATGTGGG + Intronic
1020342940 7:7132155-7132177 TGTAAGGACACTGGTCACATTGG - Intergenic
1023395240 7:39745755-39745777 TCCAGGGCCCCTGGTCAACGAGG - Intergenic
1023891467 7:44394894-44394916 TGGAGGGCTCCTGGGCACAGTGG + Intronic
1025750883 7:64293164-64293186 TGTATGGACCCTGCCCACAGGGG - Intergenic
1025784523 7:64632509-64632531 TGTCTGGTCCCTGCTCACAGAGG + Intergenic
1028587289 7:92464800-92464822 GGCAGGGCCCCTGGGCACAGAGG + Intergenic
1034289780 7:149920598-149920620 TGTAGGGGGACTGGGCACAGTGG - Intergenic
1034479762 7:151310524-151310546 TGTAGAGCACCATGTCACAGAGG + Intergenic
1034661284 7:152772229-152772251 TGTAGGGGGACTGGGCACAGTGG + Intronic
1038318945 8:26511404-26511426 TCTGGGGCTCCTGGGCACAGGGG - Intronic
1041083788 8:54238295-54238317 TTTAGGGACACTAGTCACAGTGG - Intergenic
1047210203 8:122834517-122834539 TGCAGGGCCCCTGATGGCAGAGG + Intronic
1048542767 8:135357728-135357750 TGTAAGGCCACTAGTCACATAGG - Intergenic
1048798870 8:138177724-138177746 TTTATGGACCCTGTTCACAGAGG - Intronic
1049442315 8:142614990-142615012 TGCTGAGCCCCTGGGCACAGAGG - Intergenic
1049715141 8:144086241-144086263 TGTAGGGCCCCAGGGCATGGGGG + Intergenic
1049734719 8:144198916-144198938 TGGAGGGCCTCTGATTACAGGGG + Intronic
1059395215 9:114030007-114030029 TGAAGGGCCCGCGGTCCCAGAGG - Intronic
1060816450 9:126637944-126637966 TTTAGGGCCCATGGTCGGAGGGG - Intronic
1060868946 9:127023622-127023644 TGCAGGTCCCCTGGTAGCAGAGG - Intronic
1061548001 9:131315820-131315842 TCTTGGGCTCCTGGTCACTGTGG + Intergenic
1061940731 9:133882509-133882531 TTTGAGGGCCCTGGTCACAGTGG - Intronic
1062346128 9:136116110-136116132 TGGGAGGCCCCTGGACACAGAGG - Exonic
1062630431 9:137460843-137460865 TGTAGGGCCCCGGGCCACCTTGG - Intronic
1186621598 X:11246710-11246732 TTGAGGGCCTCTGGGCACAGTGG + Intronic
1187361132 X:18628615-18628637 TGTGGCACTCCTGGTCACAGAGG - Intronic
1188863296 X:35284735-35284757 TGGAAGGCACCTGTTCACAGTGG + Intergenic
1190101888 X:47528223-47528245 TGGAGGTCCCCATGTCACAGTGG + Intergenic
1193698923 X:84740632-84740654 TGCAGGGCCCCTGATGGCAGAGG - Intergenic
1195300734 X:103527658-103527680 TTAAGGGGCCCTGGTCGCAGGGG + Intergenic
1195310723 X:103629489-103629511 TGCAGGTCTGCTGGTCACAGCGG + Exonic
1196905739 X:120432344-120432366 TGCAGGGACCCAGGTCACAAAGG + Intronic
1200135525 X:153872798-153872820 TGGAGGCCCCATGGCCACAGGGG + Intronic
1201947477 Y:19527239-19527261 TGTGGGGGCACTGGTGACAGCGG - Intergenic