ID: 1184599096

View in Genome Browser
Species Human (GRCh38)
Location 22:45532185-45532207
Sequence CTGTCCAGGGGCCTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 424}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184599096 Original CRISPR CTGTCCAGGGGCCTGGTGGA GGG Intronic
900402086 1:2476754-2476776 CTGGCCAGGTGACTGGTGGGTGG + Intronic
900513961 1:3072675-3072697 CTGGGGAGGGGACTGGTGGACGG - Intronic
900610585 1:3542968-3542990 CTGCCCAGGGGCCTGGGAGGAGG + Intronic
900972119 1:5997428-5997450 CTGACCTTGGGCCTCGTGGAGGG + Intronic
901773077 1:11540685-11540707 CTGACAAGGGGCCTTGAGGAAGG + Intergenic
902618295 1:17635752-17635774 CTGTCCAGGAGCCTAGGGTACGG + Intronic
903181769 1:21608493-21608515 CTGTGGAGTGGCCTGGGGGAAGG - Intronic
903243807 1:22001464-22001486 CTGTCCAGCCACCTGTTGGAGGG + Intergenic
903605224 1:24570670-24570692 CTGAGCAGGGGCCTGGGGGAGGG - Intronic
904622266 1:31782534-31782556 CTGGCCTGGGGTCTGGTGGGTGG - Intergenic
904870830 1:33617043-33617065 CTGTACAGGGGTCTGGTTCAGGG + Intronic
905552580 1:38855195-38855217 CAGTCCAGGGGGGAGGTGGAAGG + Intronic
905867037 1:41382153-41382175 CTGCCCGAGGGCCTGCTGGACGG + Exonic
905874956 1:41426697-41426719 CTGTCCCCGGGCCTGGTGGGAGG + Intergenic
907241892 1:53085540-53085562 CTGGCCTGGTGCCGGGTGGAGGG + Intergenic
907337865 1:53712175-53712197 CTGTGCAAAGGCCTGGTAGAAGG - Intronic
907555177 1:55337119-55337141 CAGTTCAGGGGTCTCGTGGAGGG + Intergenic
907857109 1:58314218-58314240 GTGTCCTGGGGCCTGTTGTATGG - Intronic
909498861 1:76310863-76310885 CTGTCAAGGAGTCAGGTGGAAGG - Intronic
911711771 1:101081639-101081661 CTGTCCCTGGGCGTGGTGGCGGG - Intergenic
912421521 1:109545347-109545369 TTGTCCAGGGGACTGGAGGTGGG - Exonic
912471962 1:109912262-109912284 CTCTCCAGAGGCCTTGTTGAGGG + Intronic
913094253 1:115501653-115501675 CTGTTCTGGGGTTTGGTGGAAGG + Intergenic
913285825 1:117225423-117225445 CTGGCCTGGGGCCTGGAGGAAGG + Intergenic
915933269 1:160073714-160073736 CTGGACATGGGCCTGGTGGGAGG + Intergenic
916468263 1:165093703-165093725 CTGTGCAGGGAACTGCTGGAAGG + Intergenic
916833249 1:168514398-168514420 GGGTCCAGGGCCCTGGAGGAAGG - Intergenic
916910389 1:169340177-169340199 CAAGACAGGGGCCTGGTGGAAGG + Intronic
918800205 1:188961241-188961263 CTGTTCTGGGGCCTGGAGGATGG - Intergenic
919920885 1:202165833-202165855 CCATCCAGGGGCCGGGTGGGCGG + Intergenic
920740545 1:208577552-208577574 CTGTCCAGGGTCATGGGGAAAGG + Intergenic
921724403 1:218507940-218507962 CTGTTCTGGGGTCTGGAGGATGG - Intergenic
921786479 1:219236902-219236924 CTGTCAAGGGGTGTGGGGGAGGG - Intergenic
922095983 1:222443108-222443130 CTGTCCTTGGGCCTGGAGCACGG - Intergenic
922772273 1:228192329-228192351 CAGCCCAGGCGCCAGGTGGACGG + Intergenic
923320774 1:232830860-232830882 AAGTCCAGGGGCCTGGGGGAAGG + Intergenic
924387033 1:243508593-243508615 CTGTCCAGGGCCCAGGAGCAGGG + Intronic
924806637 1:247366686-247366708 TTTTCCAGGTGCATGGTGGAAGG - Intergenic
1062877569 10:954945-954967 CTGTCCTGGGGAAGGGTGGATGG - Intergenic
1062877606 10:955075-955097 CTGTCCTGGGGAAGGGTGGATGG - Intergenic
1063381916 10:5590954-5590976 CGCTCCAGGGGCCAGGGGGAGGG + Intergenic
1063503891 10:6579690-6579712 CTGGTCAAGGGCCTGGGGGAGGG - Intronic
1063642862 10:7848546-7848568 CTGTCGAGGGACCAGGTCGAGGG - Intronic
1063949833 10:11212197-11212219 CTCCCCAGGGGCCTGCTGCAGGG - Intronic
1065125571 10:22570443-22570465 CTGGCAAGGGCCCTGGAGGATGG + Intronic
1065854336 10:29817267-29817289 CTGGCCAGGAGGCTGGTGAATGG + Intergenic
1067294048 10:44964360-44964382 ATGTCCTGGGACCTGGGGGAGGG + Intronic
1067450271 10:46377773-46377795 CTGCCCAGAGGCCTGGGAGATGG - Intronic
1067586974 10:47481990-47482012 CTGCCCAGAGGCCTGGGAGATGG + Intronic
1067634031 10:47989757-47989779 CTGCCCAGAGGCCTGGGAGATGG + Intergenic
1067779226 10:49187141-49187163 CTGCCCAGAGACGTGGTGGAAGG - Intronic
1069719549 10:70540875-70540897 CTGTCCAGGTGCTTGGTGTGAGG + Intronic
1070567548 10:77615246-77615268 CTGCTCTGGGGCCTGGTGAATGG - Intronic
1070916616 10:80159114-80159136 ATGTCCGGGGACCTGGAGGAGGG - Exonic
1071184290 10:83023072-83023094 CTCTCCAGGGGCCTGTTGGAGGG + Intergenic
1071526974 10:86364747-86364769 CTGTCGAGGGGAGTGGGGGAAGG + Intronic
1072365587 10:94705355-94705377 CTGTCCGGGGTGTTGGTGGAGGG + Intronic
1073345330 10:102778558-102778580 CTGAACAGTTGCCTGGTGGAAGG + Intronic
1073589468 10:104742676-104742698 GTGTCCAGAGGTCTGCTGGATGG - Intronic
1073919932 10:108446865-108446887 ATGTCCAGGTGCCTGGTGCCTGG - Intergenic
1074427773 10:113367380-113367402 CTGTCCAGGTGCCGGGTTGGGGG + Intergenic
1075344288 10:121670848-121670870 CTGTCCAGGGGCCAGCAGGGAGG - Intergenic
1075725561 10:124609031-124609053 CTGTCCAGAGCCCTGGGGGACGG + Intronic
1075782477 10:125026325-125026347 CTGTTCTGGGGCCTGGGTGAAGG + Exonic
1075856815 10:125636932-125636954 GTGACCTGGGGCCTGGGGGAGGG - Intronic
1076336589 10:129710542-129710564 CTGGGCAGGGGCCAGGTGTATGG + Intronic
1076698368 10:132257738-132257760 CTGCAGAGGGGCCTGGTGGAGGG - Intronic
1076939389 10:133591399-133591421 CTATCCAGGGGCCTGATGGTCGG - Intergenic
1077047606 11:553335-553357 CTGTGCAGGAGCCTGGTTAAGGG + Intronic
1077940351 11:6834246-6834268 CTGTCAAGGAGCCTGGGGGCTGG + Intergenic
1078233198 11:9461023-9461045 CTGTCCTGGTGCATGGTGGTCGG + Exonic
1079500221 11:21094410-21094432 CTGTTCTGGGGTCTGGAGGATGG + Intronic
1079927467 11:26512459-26512481 CTGGCCAGGGGGCTGGTGCGGGG - Intronic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1080235372 11:30062528-30062550 CTGACAAAGGGCCTGGGGGAGGG - Intergenic
1080635626 11:34120968-34120990 ATGTGCATGGGCCTGGGGGAGGG + Intronic
1081224489 11:40503223-40503245 CTGTCCTGGGGTCTGTAGGAAGG - Intronic
1081617604 11:44599960-44599982 CTATCCAGGGTCCTGGTGTCTGG + Intronic
1083540001 11:63505989-63506011 CTGTCCAGGGAGCTGGGGGTGGG + Intergenic
1083752492 11:64768149-64768171 CTGGCCAGGGGTGTGGTGGCAGG + Exonic
1083991677 11:66249976-66249998 CAGACCACGGGCCTGGTGGACGG - Intergenic
1084438480 11:69157487-69157509 TTGTCCAGGGGCCTGGGGGGCGG - Intergenic
1084658138 11:70531322-70531344 CTGTGCTGGGGGCTGGTGGTGGG + Intronic
1085976488 11:81661386-81661408 ATGTTGAGGGGCCTGGTGGGAGG - Intergenic
1086309780 11:85522488-85522510 CTATTCTGGGGCCTGGAGGATGG - Intronic
1086375860 11:86200168-86200190 CTGTCCAGGGGCCTGGGCCAGGG + Intergenic
1087044530 11:93833806-93833828 CTGTCCACGGGTATGCTGGAGGG - Intronic
1087686854 11:101274737-101274759 CTGTGAATGAGCCTGGTGGAGGG + Intergenic
1088972586 11:114786935-114786957 CAGACCAGGGACCTGGAGGAGGG - Intergenic
1089138887 11:116270791-116270813 CTGGGCAGGGCCCGGGTGGATGG + Intergenic
1089213186 11:116820035-116820057 CTGTCCAGGGGCCTCCTGCCAGG - Intergenic
1089286825 11:117412765-117412787 CTGTCCAGAGCCCTGCCGGAGGG + Exonic
1090531621 11:127596905-127596927 CTTGCCAGGGGCCTGGGGGTTGG + Intergenic
1090936791 11:131350213-131350235 CTAGCCATGTGCCTGGTGGAGGG - Intergenic
1091026674 11:132147764-132147786 CCGACAAGGGGACTGGTGGAAGG - Intronic
1091539720 12:1448826-1448848 CTGTTCTGGGGTCTGGAGGATGG - Intronic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1092731496 12:11539164-11539186 GTTTCCAGGGGCCGAGTGGAGGG - Intergenic
1092936278 12:13367102-13367124 CTGTCCATTGGACTGGGGGAAGG + Intergenic
1094058131 12:26286733-26286755 CTTCCCAGGGTCCTGCTGGAAGG - Intronic
1094500815 12:31019480-31019502 TTTTCCAGGGGCCGAGTGGAGGG + Intergenic
1094838011 12:34331237-34331259 CTGTGCAGGGGCTGGGGGGAAGG + Intergenic
1095249297 12:39959971-39959993 CTGTCTGGGGGCCAGGTGAAGGG - Intronic
1095748593 12:45686863-45686885 CTGCCCAAGGGCTTTGTGGAAGG - Intergenic
1097167522 12:57093663-57093685 GTGTCCTGGGGCCAGGTGGGAGG + Intronic
1098319677 12:69230888-69230910 CAGGGGAGGGGCCTGGTGGAAGG - Intergenic
1099462663 12:82943016-82943038 CTGTTCAGGTGCCTGGTGCTTGG + Intronic
1101801850 12:108029294-108029316 GCATCCAGGAGCCTGGTGGAGGG - Intergenic
1101860066 12:108475555-108475577 CTGTGCAGGGGGCTGGTTGTGGG - Intergenic
1102924452 12:116816086-116816108 CTGTCCTGGTCCCAGGTGGATGG - Intronic
1104910867 12:132240373-132240395 CTGGCCAGGTGGCTGGTGAAAGG + Intronic
1105255528 13:18741981-18742003 CCATCCAGGGACATGGTGGATGG - Intergenic
1105582867 13:21717419-21717441 CTGCTCAGCCGCCTGGTGGAGGG - Intergenic
1106099582 13:26682779-26682801 GTGACCAGGAGCCCGGTGGAGGG - Exonic
1106495630 13:30271621-30271643 TGGTGGAGGGGCCTGGTGGAAGG - Intronic
1107014213 13:35695691-35695713 CTGTCCTCGGGCATGGTGGCCGG + Intergenic
1107157083 13:37181021-37181043 CAGCCCTGGGGCCAGGTGGATGG - Intergenic
1108568812 13:51729308-51729330 CTGTTTAGGGGCCTGGGAGAAGG - Intronic
1109185468 13:59262684-59262706 GTGTCCAGGGGCCTCTTGCAGGG - Intergenic
1112326593 13:98446006-98446028 CAGCCCAGGGCCCTGGTGCAGGG + Intronic
1113060169 13:106314160-106314182 ATGTTCAGGGACCTGGGGGAAGG + Intergenic
1113209640 13:107960539-107960561 CTTTGCAGGGGGCTGGGGGATGG + Intergenic
1113446240 13:110369824-110369846 CTGGACAGGGGGCTGGTGGGTGG - Intronic
1115443455 14:33462519-33462541 GTGTCCTGGGCCCTGGAGGAAGG + Intronic
1117282928 14:54258295-54258317 CTGTAGAGGGGCCTGCTGGCTGG - Intergenic
1117602447 14:57390130-57390152 CTGACCAGGGGCAAGGAGGATGG - Intergenic
1118208733 14:63747359-63747381 CTGGTCAGGGTCCTGGGGGAAGG + Intergenic
1118324347 14:64771226-64771248 CTGCCCAGGGCACTGCTGGAAGG + Intronic
1118353062 14:64987677-64987699 CTGACCAGGAGCCTGGTTGGGGG + Intronic
1119441353 14:74630900-74630922 CTGTGGAGGGGCCAGGTGTAGGG + Intergenic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120940336 14:89941940-89941962 CAGGGCAGGGGCCTGGTGGGAGG + Intronic
1121266004 14:92603081-92603103 CGGCCCAGGGCCCTGGTGGGTGG + Intronic
1121631103 14:95422570-95422592 CTGACCTGGGGCCTGGAGGGAGG + Intronic
1122270212 14:100565619-100565641 CAGTCCAGGGGCCAGGAGGCAGG + Intronic
1123943098 15:25226041-25226063 GTCTCCTGGAGCCTGGTGGAGGG + Intergenic
1124558677 15:30750535-30750557 CTGGCCAGAGACCTGCTGGAAGG + Intronic
1124658633 15:31527674-31527696 CTGTCCAGTGTCCTTATGGAGGG + Intronic
1124672574 15:31655095-31655117 CTGGCCAGAGACCTGCTGGAAGG - Exonic
1127832530 15:62763559-62763581 CTGTCCAGGGGCCTTGTCCCTGG - Exonic
1128074592 15:64818298-64818320 GTGTCTCGGGGCCTGGTGAATGG - Exonic
1128095060 15:64947741-64947763 CTGTGCAGAGGCCTGGAGGAGGG - Intronic
1128345165 15:66848793-66848815 CTGGCCAGGGGCCCTGTGTAGGG + Intergenic
1129125389 15:73436173-73436195 CTTTCCAGGGGCTTGGGGGAGGG + Intergenic
1129614468 15:77087407-77087429 CTGTGCAGGGGCCTGGGGCTGGG - Intergenic
1130060839 15:80568870-80568892 CTCAGCAGGGGCCTGATGGAAGG - Intronic
1130383456 15:83391737-83391759 CTGGCCAGGGGCCACATGGATGG + Intergenic
1130543654 15:84839722-84839744 CTGGGCAGAGGCCTGGTAGATGG - Exonic
1130965333 15:88693451-88693473 CTGACCCAGGGCCTGCTGGAGGG + Intergenic
1131117455 15:89803857-89803879 CTGCCCAGGGGTCTGGTGCGGGG - Intronic
1132195702 15:99913258-99913280 TTGTCCAGCGTCCTGGTGGAAGG - Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1132289003 15:100686302-100686324 AGATCCAGGGGCCTGGGGGATGG - Intergenic
1132998617 16:2837827-2837849 CTGGACAGGGGCCTCCTGGATGG + Intronic
1133022344 16:2972326-2972348 CTGGCCACAGGCCTGGTGGGAGG - Exonic
1133267576 16:4594194-4594216 CAGGCCTGGGGCCTGGCGGATGG - Intronic
1134028965 16:10976752-10976774 CAGGGCAGGGGCCTGGGGGAGGG + Intronic
1134837622 16:17375392-17375414 TTGCCCAGGGGTCTGTTGGATGG - Intronic
1135988457 16:27202052-27202074 AAGTTCAGGGGCCTGGAGGAAGG + Intergenic
1136466167 16:30445453-30445475 CTGGGCCGGGGCCTGGTGGGTGG - Exonic
1137251697 16:46745929-46745951 GTGTTCTGGGGCCTGGGGGATGG + Intronic
1137285626 16:47013944-47013966 ATGTCCTGGGGCCTGGAGAAAGG - Intergenic
1138337947 16:56267624-56267646 CAGTACAGGTGCATGGTGGAGGG - Intronic
1138681633 16:58687767-58687789 GTTGCCAGGGGCTTGGTGGAGGG - Intergenic
1139922510 16:70468961-70468983 CTGTCCAGGTGACTGGGGGAGGG + Exonic
1141422357 16:83925361-83925383 CTGTCCAGGGGCCCGGGGACGGG - Exonic
1142979578 17:3663878-3663900 CTCTCCTGGGGCCAGGTGAACGG - Exonic
1143464797 17:7129501-7129523 CTGTCCACTTGCCTGGTGAAAGG - Intergenic
1143625588 17:8108795-8108817 CTGCACAGGGGCCTGGGGGGTGG + Intronic
1144377233 17:14656812-14656834 CAGTCCAGGGACCTGGTAGAAGG - Intergenic
1144650612 17:17004681-17004703 CAGCCCAGGGGCGTGGTGGAGGG - Intergenic
1146182187 17:30705636-30705658 CTGTCCAGGAGCCTGAGGCAGGG + Intergenic
1146911284 17:36649939-36649961 CTGACCTGGGGGCTGGGGGAGGG + Intergenic
1147186076 17:38713668-38713690 CTTTCCAGGGGCCTGCAGGCAGG + Intronic
1148015661 17:44520230-44520252 ATGTCCATGGGTCTGGTGTAGGG + Intergenic
1148392752 17:47284702-47284724 CTGTCCTGGCGTCTGGAGGAGGG - Intronic
1148443525 17:47724338-47724360 CTGCCCATGGCCCTGGTGGGAGG + Intergenic
1148687695 17:49509753-49509775 CTGTCCAAGGGCTGGCTGGAGGG + Intronic
1149348390 17:55762210-55762232 AAGTTCAGGGGCCTGGAGGAAGG + Intronic
1149370930 17:55992895-55992917 CTTTTCTGGGGCCTGGAGGATGG + Intergenic
1149936279 17:60810340-60810362 GGGTCCAGGGGCCTGGTTGTGGG + Intronic
1150598367 17:66627289-66627311 CTGTCCTGGGGCGTGGGGGTTGG + Intronic
1151268218 17:72972987-72973009 CTGTCCAGGAGCTCGGTTGAAGG - Intronic
1151365397 17:73613379-73613401 CTCTCCAGGGGCCTGGGGCCAGG - Intronic
1151566658 17:74902312-74902334 CAGCCCAGGGACCTGGCGGATGG - Intergenic
1152133714 17:78492113-78492135 CTGACCAGGAGCCTAGGGGAGGG - Intronic
1152386404 17:79977414-79977436 CTGGGAAGGGGCCAGGTGGAGGG - Intronic
1152595130 17:81234185-81234207 CTCTGCAGGGTCCTGGAGGAGGG - Intronic
1152644340 17:81461837-81461859 CTGTCCAGGGCCACGGTGGCTGG + Exonic
1152759852 17:82102101-82102123 ATGTCCAGGTGCCCAGTGGAGGG - Intronic
1152880016 17:82809198-82809220 CTGGCCAGGGGCCTCCAGGAAGG - Intronic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1153174381 18:2354478-2354500 GTGGCCAGGGGCTTGGAGGAGGG - Intergenic
1153762733 18:8347593-8347615 GGGTCCAGGTGCCTGATGGAAGG - Intronic
1153880723 18:9419565-9419587 CTCACCAAGGGCCTGCTGGACGG - Intergenic
1154435492 18:14338623-14338645 CCATCCAGGGACATGGTGGATGG + Intergenic
1155990708 18:32276253-32276275 CTGTCCTGGGGGCTGATGGCCGG + Intronic
1157077291 18:44479679-44479701 CTGTTCCGGGGTCTGGAGGATGG - Intergenic
1157291129 18:46410650-46410672 TTGTCCATGGGCCTGGCTGAAGG + Intronic
1158020561 18:52836756-52836778 CTGTCATGGGGTCTGGAGGATGG + Intronic
1159865567 18:73700477-73700499 CAGTGCAGGAGCCTGGTGGGAGG - Intergenic
1160382366 18:78470139-78470161 TGGACCAGGGGCCTGGTGGGAGG + Intergenic
1160832865 19:1111695-1111717 GGGTCCAGGGGCCTAGGGGAGGG - Intronic
1160942508 19:1627018-1627040 CTGCACAGGGGCCTGTTGTATGG + Intronic
1161398976 19:4059281-4059303 CTTTCCTGGGGCCTGGAGGATGG + Intronic
1162530234 19:11231751-11231773 CTTTCCAGGTACCTGGTGTAGGG - Intronic
1162767774 19:12930391-12930413 CTGGTCAGGGGGCAGGTGGACGG - Intronic
1162851808 19:13436897-13436919 CAGTCCAGGGGCCTTGAAGAGGG - Intronic
1162976645 19:14210166-14210188 CTGTCCAGGAGCCTGAGGCAGGG - Intergenic
1163035402 19:14566495-14566517 CTCTCTAGGGGCCTGTTTGATGG - Intronic
1163174188 19:15552664-15552686 CTCACCAGGGGCCAGGTGGTTGG + Intergenic
1163455810 19:17405087-17405109 CAGTCCAGGGCACTGGTGTAGGG - Intronic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1165097522 19:33417694-33417716 CTGTTCAGAGGCCTGGAGGGAGG + Intronic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165419495 19:35715942-35715964 CTGTGCGGGGCCCTGGGGGAGGG - Exonic
1166370057 19:42295400-42295422 ATGTACAGGGGCTTGGAGGAGGG - Exonic
1166768201 19:45264990-45265012 CTGTCCAGCGACCTGGGGGCGGG + Intronic
1166976785 19:46609545-46609567 CTGTCCCGGGACCTGCTGGGAGG + Exonic
1167237065 19:48321556-48321578 CTTACGAGGGGCCCGGTGGAAGG + Intronic
1168308552 19:55449855-55449877 CTGGGCAGGGGGCTGGTGGGGGG - Intergenic
1168405475 19:56108237-56108259 CTGGGCAGGGGCGAGGTGGAGGG - Intronic
1168405487 19:56108272-56108294 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405514 19:56108341-56108363 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405541 19:56108411-56108433 CTGGGCAGGGGCAGGGTGGAGGG - Intronic
925257064 2:2499372-2499394 CTGTTCTGGGGTCTGGAGGATGG + Intergenic
925730526 2:6917295-6917317 CTGTCCTGGGGCCTGCGGGGCGG + Intergenic
927685749 2:25169152-25169174 CTCTCCAAGGGCCTGGTTTAGGG + Intergenic
929075225 2:38075062-38075084 CTGCACCAGGGCCTGGTGGATGG + Exonic
930748203 2:54906387-54906409 CTGTGGAGGGGCCTGGGGGAAGG + Intronic
930812951 2:55561452-55561474 CTGTTCTGGGGTCTGGAGGATGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934113049 2:88759924-88759946 CTGTTCTGGGGTCTGGAGGACGG - Intergenic
934490530 2:94759525-94759547 CCATCCAGGGACATGGTGGATGG - Intergenic
934653649 2:96106135-96106157 CTGCTCAGAGGCCTGATGGAAGG - Intergenic
936532241 2:113284258-113284280 GTGCCCAGGGGCCTGGTGAAGGG + Intergenic
936586907 2:113766014-113766036 TTGGACAGGGGCCTGGTGGGGGG - Intergenic
937263618 2:120601997-120602019 CTGGGCAGGGGCATGGTGGGTGG - Intergenic
939250192 2:139672803-139672825 TTGCCCAGGGTCCTGGTTGAAGG + Intergenic
939361129 2:141174407-141174429 CAGGGGAGGGGCCTGGTGGAAGG + Intronic
942323623 2:174756993-174757015 CTGTCGTGGGGCCCAGTGGATGG + Intronic
943456927 2:188120116-188120138 CAGTGGAGGGGCCTGGTGGGAGG - Intergenic
943912492 2:193586380-193586402 CAGAGCAGGGGCCTGGTGGGAGG + Intergenic
944676311 2:202035836-202035858 CTGGCCATGGGCCAGGTAGACGG + Exonic
945042311 2:205752468-205752490 CTCCCCAGTGCCCTGGTGGAAGG - Intronic
946161823 2:217840193-217840215 CTGCTCAGGGGCATGGTGTAGGG + Intronic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
948263701 2:236622495-236622517 GTGTCCTGGGGCCTCCTGGAAGG + Intergenic
948592392 2:239059823-239059845 CTGTCCTGCAGGCTGGTGGATGG - Intronic
948888235 2:240894395-240894417 CTGTGCAGGGGCCAGGATGATGG - Intronic
948916840 2:241038813-241038835 CTGGCCAGGGGCCTGGCTGCGGG + Intronic
949029967 2:241789709-241789731 CCGTCCCGGGGCATGGTGGTGGG + Intronic
1169193183 20:3670385-3670407 CTGCCTAGGGCCCTGGTGCAGGG + Intronic
1169756461 20:9048296-9048318 CTGTCAAGGGGCCAGTGGGAGGG + Intergenic
1170775713 20:19373111-19373133 CTGTCCAGGGGCTTGCAGGTGGG + Intronic
1171487072 20:25493048-25493070 CTGTCCTGGAACCTGGTGGAGGG - Intronic
1171880337 20:30613933-30613955 CCATCCAGGGACATGGTGGATGG - Intergenic
1172006453 20:31821766-31821788 CTGCCCTGGGGCCAGGGGGAGGG + Intronic
1172177260 20:32979991-32980013 CTGTCCAGGGGTCTCGTGCAGGG + Intergenic
1172271423 20:33657706-33657728 CTGGACTTGGGCCTGGTGGAAGG - Exonic
1173539823 20:43842950-43842972 CTTTCCAAGGGCCAGGTGGCAGG - Intergenic
1173558467 20:43984822-43984844 AAGTGCAGGGGCCTGGGGGAGGG + Intronic
1173691394 20:44963971-44963993 TTGTCTAAGGCCCTGGTGGAAGG - Intergenic
1174110830 20:48196711-48196733 CGGTCCACGGGCCTGGGGGTTGG + Intergenic
1174553314 20:51376715-51376737 GAGTCCAGGGGCATGGGGGAGGG - Intergenic
1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG + Exonic
1175232746 20:57484287-57484309 GTCTCCAGGGGCTGGGTGGAGGG + Intergenic
1175531380 20:59675809-59675831 CTGGGGAGGGGCCTGGTGCAGGG - Intronic
1176841540 21:13847010-13847032 CCATCCAGGGACATGGTGGATGG - Intergenic
1177810967 21:25924606-25924628 CTGTCCAGGGGTGGGGTGAAAGG + Intronic
1177970604 21:27784843-27784865 CGGTGGAGGGGCCTGGTGGGAGG - Intergenic
1178347685 21:31845647-31845669 ATGTGCAGGGGCCTGGTTGTTGG - Intergenic
1178452182 21:32712598-32712620 CTTGCCAGGGGCCTGGTGCATGG - Intronic
1178502737 21:33139399-33139421 CTTTCCAGAGGCCAGGTTGAAGG - Intergenic
1179016154 21:37595849-37595871 CTGCCCAATAGCCTGGTGGATGG + Intergenic
1179534929 21:42045297-42045319 CTGTTCAGGGTCCTGGAGGAGGG - Intergenic
1179540433 21:42079961-42079983 CTGTGCCGGGGCCTGGTGAAGGG + Intronic
1179594175 21:42431013-42431035 CCCTCCAGGGTCCTGGTGCAGGG + Intronic
1180703429 22:17794246-17794268 CTATCCAGGGGCTTTGAGGAGGG - Intronic
1181085708 22:20438413-20438435 CGGACCAGAGGCCTGGGGGAAGG + Intronic
1182085272 22:27556927-27556949 CTGTGCTGGGGCCAGGTGGAGGG - Intergenic
1182453267 22:30433609-30433631 CCTTCCAGGTGCCTGGTGAACGG + Intergenic
1183038915 22:35161648-35161670 CTGTGCAGGGGCCTGCACGAGGG + Intergenic
1183107157 22:35622771-35622793 CTGTCCAGGTGACAGGTGGATGG - Intronic
1183217520 22:36490457-36490479 CTGCCCTGGAGCCTCGTGGAGGG - Intronic
1183319659 22:37157266-37157288 CTGTCTTGGGGACTGGTGGGTGG - Intronic
1183538251 22:38415528-38415550 CAGCCCAGGGGTTTGGTGGAGGG + Intergenic
1183971996 22:41484398-41484420 CAGGCCAGGGAGCTGGTGGATGG + Intronic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184147317 22:42619230-42619252 CTGGCCAGGGCCCTGGGGTAGGG + Exonic
1184561863 22:45268408-45268430 CTGTGCGGGGACCTGGAGGAGGG - Intergenic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
1184637780 22:45848879-45848901 CTGTTCAGGGACCAGGTGGGTGG + Intergenic
1184695613 22:46137300-46137322 CTGTCCATGGGCCTGGGGCACGG - Intergenic
1185014560 22:48335425-48335447 CTGTCCTGGGGCCTCCTGCATGG - Intergenic
1185045333 22:48525756-48525778 CTCTGCAGGGGCCTGGAGGCAGG - Intronic
950641807 3:14353426-14353448 CTGGGCAGGGGACTGGAGGAGGG - Intergenic
952242951 3:31552712-31552734 CTGTCCAAAGGACTCGTGGATGG - Intronic
953018973 3:39101831-39101853 CAGTCCTGTAGCCTGGTGGAAGG - Intronic
953545834 3:43863116-43863138 TTGTGCAGGTGCCTGGTTGAGGG + Intergenic
953872165 3:46636077-46636099 CTGTTCTTGGGCCTAGTGGAAGG + Intergenic
953876016 3:46667326-46667348 CTCCCCAGGGGCCTCCTGGATGG - Intergenic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
956750747 3:72342120-72342142 CTGTGCAGAGGCCTGGAGGCAGG + Intergenic
958917398 3:100064867-100064889 TTGGCCAGGGGCCTGGGGGTGGG + Intronic
959129818 3:102340486-102340508 ATGGCCAGGGGCCTGGAAGAAGG + Intronic
959717071 3:109444527-109444549 CTGTCCAAGGGCCTTGGGGGTGG + Intergenic
961058646 3:123810232-123810254 CTGTCCTGAGGTCTGGGGGAGGG - Intronic
961779125 3:129311278-129311300 CTGTCCTGGGGCCAGGGAGAAGG + Intergenic
961990370 3:131183432-131183454 CTGTCATGGGGCCAGGGGGAGGG - Intronic
962834874 3:139181199-139181221 GTGTGCATGGGCCTGGTGCATGG + Intronic
962860585 3:139396818-139396840 CTGTTAAGGTTCCTGGTGGAAGG + Intergenic
963671645 3:148258706-148258728 CTGTTCTGGGGTCTGGAGGATGG - Intergenic
963932735 3:151020986-151021008 CTGTCCTTGCTCCTGGTGGATGG - Intergenic
967187136 3:186953978-186954000 CTGTCAGGGGGCCTGGGGGAGGG - Intronic
967924732 3:194637267-194637289 CTGCCCCAGGGCCTGGTGGGAGG - Intergenic
968235260 3:197027490-197027512 CTTGGCAGGGGCCTTGTGGAAGG + Intronic
968269579 3:197393131-197393153 CTGTCCAGTGGCCTGACCGAGGG + Intergenic
968395537 4:233273-233295 TAGTCCAGTGGCCTGGGGGAAGG + Intergenic
968414368 4:417411-417433 TAGTCCAGGGGCCTGGGAGAAGG + Intergenic
968434742 4:578628-578650 CTGTGCAGAGGCCCGGTGGCAGG - Intergenic
968619704 4:1598340-1598362 CGGGCCAAGGGCCTGGCGGAAGG - Intergenic
968897128 4:3410943-3410965 CTGTCCAGGGACTTGGCTGATGG + Intronic
968909997 4:3472818-3472840 CTGGGCAGTGGCCGGGTGGATGG + Intronic
969623430 4:8290360-8290382 AGGACCAGTGGCCTGGTGGAGGG + Intronic
969674697 4:8608230-8608252 CCATCAAGGGGCCAGGTGGAGGG - Intronic
970361290 4:15311085-15311107 CTGTTCTGGGGTCTGGAGGATGG - Intergenic
973577349 4:52303366-52303388 GTGTCCAGAGGCCTGATGAAAGG + Intergenic
975321314 4:73012115-73012137 TAGTCCAGGGGACTGGTGGCTGG - Intergenic
977545090 4:98367488-98367510 CCGTCCTGGGGTCTGGAGGATGG - Intronic
978159870 4:105533190-105533212 CTGTCAAGGGGCGGGGTGGGGGG - Intergenic
978954678 4:114599080-114599102 CTGTCCAGGGGCGGGGGGGTGGG + Intronic
985016653 4:185643206-185643228 CTGTGCTGGGACCTGGAGGATGG + Intronic
985691450 5:1314924-1314946 CAGGCCAGGGGTCTGGAGGAAGG - Intergenic
985935784 5:3096739-3096761 CTGTCTTGGTGCCTGGTGGGTGG - Intergenic
985982556 5:3483096-3483118 GTGCCCAGGAGGCTGGTGGAGGG + Intergenic
986164493 5:5261931-5261953 CTGGCCAGGGTCTTGGAGGAGGG - Intronic
986582477 5:9279613-9279635 CAGTGGAGGGGCCTAGTGGAAGG + Intronic
987492235 5:18595691-18595713 CTGAAAAGGGGCCTGGTGGGAGG - Intergenic
987743662 5:21942951-21942973 GTGTTGAGGGGCCTGGTGGGAGG + Intronic
988387148 5:30579464-30579486 CTGGCCAGGGCCCTGGGGAAGGG + Intergenic
988971334 5:36471276-36471298 CTGTCAAGGGGTGGGGTGGAAGG + Intergenic
991763858 5:69953103-69953125 GTGTTGAGGGGCCTGGTGGGAGG + Intergenic
991783467 5:70165032-70165054 GTGTTGAGGGGCCTGGTGGGAGG - Intergenic
991843089 5:70828173-70828195 GTGTTGAGGGGCCTGGTGGGAGG + Intergenic
994028914 5:95118014-95118036 CTGTCAAGGGGTGAGGTGGAGGG + Intronic
995991757 5:118247834-118247856 CTGTCCAGGGGCCTGGAGATTGG + Intergenic
996379568 5:122849409-122849431 GTATCCAGGGGCCTGAGGGAGGG + Intronic
997743434 5:136278041-136278063 CTGTCCAAGGACCTGGGTGAGGG + Intronic
998034010 5:138898031-138898053 ATCTCCAGGGACCTGGTGGGAGG + Intronic
999088002 5:148910612-148910634 CTTGTCAGGGGCCTGGGGGATGG + Intergenic
999261717 5:150242605-150242627 CTTTGCAGGGGCCTGGTGAGAGG - Intronic
999307886 5:150532393-150532415 CTTGCCAGAGGCCTGGCGGACGG + Intronic
999414957 5:151387004-151387026 AACTCCTGGGGCCTGGTGGAGGG + Intergenic
999499558 5:152133034-152133056 CTGTCCTAGGGCCTTGTGGAAGG - Intergenic
1002059085 5:176615791-176615813 CTGGCCAGGGTCCAGGCGGAAGG - Intergenic
1002114122 5:176944922-176944944 CTGTCCAGCGGCTTGTTGGGAGG - Intronic
1002580660 5:180208079-180208101 CTGTGCAGGCGACCGGTGGAGGG - Intronic
1004148532 6:13092257-13092279 CAGTCCTGGGGCCTGGGGGTTGG + Intronic
1004287945 6:14339887-14339909 TGGGCCAGGGGCCTGGTGGCAGG + Intergenic
1004291716 6:14373683-14373705 CTGGTCAGGGGCATGGTGGGTGG + Intergenic
1005246459 6:23891349-23891371 CTGTCCAGAAGCCTGGTGGGGGG - Intergenic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006453699 6:34120263-34120285 CTGTGCTGAGGCCTCGTGGAGGG - Intronic
1006581887 6:35082127-35082149 CTGTCCAGGGCACTGGTGGAAGG - Intronic
1006808096 6:36801785-36801807 GTGACCAGGGGCAGGGTGGAGGG + Intronic
1006922038 6:37633559-37633581 CTGTCTGGGGGCCTGGGAGAAGG + Exonic
1007743170 6:44025100-44025122 CAGGCCTGAGGCCTGGTGGAGGG - Intergenic
1007811853 6:44491896-44491918 ATGTCCAAGTGCCTGGAGGATGG + Intergenic
1008332391 6:50260315-50260337 GTGTCCATGGGCCTGGGGTAGGG + Intergenic
1009029382 6:58038224-58038246 CTGTCCAGTGGCCAGGTGGATGG - Intergenic
1009204924 6:60789614-60789636 CTGTCCAGTGGCCAGTTAGATGG - Intergenic
1010898325 6:81393231-81393253 TTGAGGAGGGGCCTGGTGGAGGG + Intergenic
1011855027 6:91679212-91679234 GTGTCCAGGATGCTGGTGGAGGG + Intergenic
1011942252 6:92857248-92857270 CTATCCTGGGGTCTGGAGGATGG + Intergenic
1012500084 6:99879057-99879079 ATGTCGGGGGGCCTGGTGAATGG + Intergenic
1012644009 6:101657202-101657224 CTGGGCAGAGACCTGGTGGAAGG + Intronic
1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG + Intergenic
1016246148 6:141983621-141983643 CTGTTCAGGAGGCTGGTGGGTGG + Intergenic
1016687828 6:146901205-146901227 CTGCCCCGGCGCCTGGTGCACGG + Intergenic
1017379336 6:153810337-153810359 TTGAAGAGGGGCCTGGTGGAAGG + Intergenic
1018025125 6:159799808-159799830 ATGTCCAGGGGCGTGGGAGAGGG + Intergenic
1018829112 6:167428978-167429000 CTGTGCAGATGCCTGGAGGATGG - Intergenic
1018935857 6:168273813-168273835 CTGGCCAGGGCCCTGGTTGGCGG + Intergenic
1019565382 7:1676343-1676365 CTGTCCTGTGGAATGGTGGAAGG + Intergenic
1020085682 7:5308999-5309021 CTGTCCTGGGGCCTGGGGTCGGG - Intronic
1020427475 7:8085581-8085603 CAGTGCAGGTGCCTAGTGGAGGG + Intronic
1021093486 7:16509773-16509795 GGGTCCTGGGGCCTGGTGAAGGG - Intronic
1022496265 7:30854956-30854978 CTGTCCAGGCGCATGGGAGAAGG + Intronic
1023810427 7:43906813-43906835 CTGCCCAGGTGCCTGGAGGCCGG + Exonic
1023988666 7:45114256-45114278 CTGTCCATGGGACAGGGGGAAGG - Intergenic
1024056708 7:45664089-45664111 CTCCCCTGGGGGCTGGTGGAGGG + Intronic
1024311417 7:47972954-47972976 CTGAGAAGGGGCCTGGTGGTAGG + Intronic
1024621210 7:51159071-51159093 CTGGCCAGGAGCTTGGAGGAGGG + Intronic
1025208629 7:57008165-57008187 CTGTCCTGGGGCCTGGGGTCAGG + Intergenic
1025663318 7:63568713-63568735 CTGTCCTGGGGCCTGGGGTCAGG - Intergenic
1025757380 7:64357598-64357620 CTGTGCAGTGGCCTGGTAAAAGG + Intergenic
1026102720 7:67396199-67396221 CAGTTCAGGGGCCTGGGGGAAGG - Intergenic
1026132238 7:67630170-67630192 CTGTCCAAGGGCCTTATGGGTGG - Intergenic
1026676530 7:72433196-72433218 CTGGTCAGGGGGCTGCTGGAGGG - Intronic
1029236816 7:99126962-99126984 CTGAGCAGGGGCCGGGGGGAAGG + Intronic
1029344293 7:99967243-99967265 TTCTCCTGGGGCCTGGTGGCTGG + Exonic
1029347200 7:99987279-99987301 TTCTCCTGGGGCCTGGTGGCTGG - Intergenic
1029481226 7:100814124-100814146 CAGTACAGGGGACAGGTGGAGGG + Intronic
1030826850 7:114169181-114169203 CTGTTCTGGGGGCTGGAGGACGG - Intronic
1034262443 7:149765288-149765310 CTGGCCAGGGGCTTGGCGGCGGG + Exonic
1035796584 8:2362817-2362839 CTGTGCATGGACCTGATGGAGGG - Intergenic
1035843260 8:2835319-2835341 CAGGGCAGGGGCCTGGTGGGAGG - Intergenic
1036645356 8:10608911-10608933 CTGTCCAGGGAGCTGAGGGAGGG - Exonic
1036738480 8:11340508-11340530 TTCTCCAGGGGCCTGCTGGAGGG + Intergenic
1037816836 8:22116908-22116930 CTCTCCGGGGGCCTGGAGCAGGG + Exonic
1039336614 8:36598046-36598068 TTATCCAGGGACCTGATGGATGG + Intergenic
1040798022 8:51308390-51308412 CTGGGGAGGGGCCTGGTGGGAGG + Intergenic
1042658830 8:71131795-71131817 CTGTCCCGGGGCCTGAGGGCAGG + Intergenic
1042982078 8:74540864-74540886 CTGTTCTGGGGTCTGGAGGATGG + Intergenic
1044116560 8:88343169-88343191 CTGTCAAGGGGGGTGGTGGGGGG - Intergenic
1045320670 8:101079764-101079786 CTGACCAGGGGCCAGGATGATGG - Intergenic
1045394022 8:101742818-101742840 CTGTCCAGGGGTTGGATGGAGGG - Intronic
1046121076 8:109848316-109848338 CTGTCCAGGGGCATGATGACAGG - Intergenic
1048531007 8:135250531-135250553 CTGTCCAGGGGCTAGGGGGTGGG + Intergenic
1048971708 8:139648733-139648755 GAGTCCAGAGGCCTGGTGGTGGG - Intronic
1049306679 8:141907730-141907752 CGGTGCAGGGGCCTGCAGGACGG + Intergenic
1049414449 8:142488899-142488921 GCGTCCAGGGCCCTGGCGGATGG - Intronic
1049468504 8:142764576-142764598 GCGTCCGGGGGCCTGGAGGAGGG + Exonic
1049483092 8:142836699-142836721 CTCTCCAGGAGCCTGTGGGAAGG + Intronic
1049498124 8:142946243-142946265 GTGTGCAGGGGGCTGGTGAAGGG - Intergenic
1049599904 8:143502899-143502921 CAGTCCTGGGGCCCGGGGGAGGG + Intronic
1050131934 9:2422110-2422132 CTGTTGAGGGTCCTGGTGGGAGG - Intergenic
1051466642 9:17385345-17385367 CTCTGCAGAGGCCTGGTGGTGGG + Intronic
1053001061 9:34577676-34577698 GTGTCCATTGGCCTGGGGGAGGG - Intronic
1053153175 9:35755783-35755805 CTGGCCTGTGGCCTGGGGGATGG + Exonic
1053266125 9:36714760-36714782 CTGGCCCGGTGCCTGGTGGAGGG - Intergenic
1053667465 9:40326168-40326190 CCATCCAGGGACATGGTGGATGG + Intronic
1053729577 9:41039611-41039633 CTGTCCAGGGCCATGCTGGTTGG + Intergenic
1053917045 9:42951271-42951293 CCATCCAGGGACATGGTGGATGG + Intergenic
1054517146 9:66050117-66050139 CCATCCAGGGACATGGTGGATGG - Intergenic
1054698930 9:68392451-68392473 CTGTCCAGGGCCATGCTGGTTGG - Exonic
1056057568 9:82843230-82843252 CTGTCGAGGGGTCAGGGGGAGGG + Intergenic
1057167518 9:92940611-92940633 CTGGCCAAGGGCCCAGTGGAGGG - Intergenic
1057442840 9:95094490-95094512 CTTCCCAGGGACCTGGGGGAGGG - Intergenic
1058706104 9:107639032-107639054 CTGCCCTGTGGCCTGGAGGAGGG - Intergenic
1058887159 9:109330266-109330288 TGGTCCAGGGGCCTGAGGGATGG - Intergenic
1059335736 9:113567395-113567417 CTGGCCAGGGGCCTGGGGCATGG + Intronic
1060413229 9:123413590-123413612 GGGTCCAGGGACTTGGTGGAGGG + Intronic
1060599723 9:124869664-124869686 GGGTCCAGGGGCCTGCGGGACGG - Intronic
1061004075 9:127918457-127918479 CTATCCAGGGGCTGGGAGGAGGG + Intergenic
1061231395 9:129317949-129317971 GTCTCCTGGGGGCTGGTGGAGGG - Intergenic
1061533569 9:131233456-131233478 CTGTCCAGGGTTTTGGTGGCTGG + Exonic
1061593760 9:131615472-131615494 CTGTGCAGGGGACGGTTGGAGGG + Intronic
1062250061 9:135589364-135589386 CTGTCCATGGGCCCAGTGCAGGG - Intergenic
1062335259 9:136062320-136062342 CTTTCCAGGGTCCGGGTAGATGG - Intronic
1062358598 9:136176913-136176935 CTGGCCCGGGGCCTGGAGTACGG - Intergenic
1062376920 9:136266032-136266054 CTGTCCAGGCACCTGGGGGGAGG + Intergenic
1062491365 9:136806696-136806718 CTGCCCAGGGACCTGGTGTGTGG - Intronic
1062577425 9:137215200-137215222 CTGGTGAGGGGCCTGGTGGTTGG + Exonic
1185460975 X:332697-332719 CTGTCGGGGGTCCTCGTGGACGG - Intergenic
1185621608 X:1453767-1453789 GTGTCCACGGGCCTGGTGGGAGG + Intergenic
1185621623 X:1453805-1453827 GTGTCCACGGGCCTGGTGGGAGG + Intergenic
1185621638 X:1453843-1453865 GTGTCCACGGGCCTGGTGGGAGG + Intergenic
1185621653 X:1453881-1453903 GTGTCCACGGGCCTGGTGGGAGG + Intergenic
1185621668 X:1453919-1453941 GTGTCCACGGGCCTGGTGGGAGG + Intergenic
1185621683 X:1453957-1453979 GTGTCCACGGGCCTGGTGGGAGG + Intergenic
1187583657 X:20636432-20636454 CTGTGCAGGGGCCAAGTGGCAGG - Intergenic
1187950596 X:24466224-24466246 CTGTCCGGTGGGCTGGTGGGCGG + Intronic
1189042625 X:37558609-37558631 CTTTCCAGGGGGCTGGATGAGGG - Intronic
1189207840 X:39257037-39257059 GTGTCCAGGTGGCTGGGGGAGGG - Intergenic
1191024938 X:55904149-55904171 GTGTCCTGAGGCCTGGAGGAAGG + Intergenic
1193066419 X:77265072-77265094 CTGTTCTGGGGTCTGGAGGATGG - Intergenic
1193622392 X:83772024-83772046 CTGTGCAGGGACCTGCTGGAAGG - Intergenic
1194154625 X:90371858-90371880 ATGTACAGGGGTCTGGAGGAAGG - Intergenic
1194259683 X:91677881-91677903 CTATTCAGGGGTCTGGAGGATGG + Intergenic
1200500977 Y:3948744-3948766 ATGTACAGGGGTCTGGAGGAAGG - Intergenic
1200578385 Y:4917074-4917096 CTATTCAGGGGTCTGGAGGATGG + Intergenic