ID: 1184599204

View in Genome Browser
Species Human (GRCh38)
Location 22:45532694-45532716
Sequence CAGGTACATGAGGCCTAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184599197_1184599204 28 Left 1184599197 22:45532643-45532665 CCATGGTAGTGGGCTTGGAGCAG 0: 1
1: 0
2: 1
3: 13
4: 197
Right 1184599204 22:45532694-45532716 CAGGTACATGAGGCCTAGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184599204 Original CRISPR CAGGTACATGAGGCCTAGTT GGG Intronic
902447901 1:16478682-16478704 CAGGTAGAAGAGGCCAGGTTAGG + Intergenic
902506775 1:16943819-16943841 CAGGTAGAAGAGGCCGAGCTAGG - Intronic
902754230 1:18538566-18538588 CTGGTACATGTGGGCTAGGTTGG - Intergenic
907691228 1:56668747-56668769 CAGTTTCATAAGGCATAGTTTGG - Intronic
1067491764 10:46714717-46714739 CAGGTACATGAGCCCGAATTTGG - Intergenic
1067602895 10:47625659-47625681 CAGGTACATGAGCCCGAATTTGG + Intergenic
1069764938 10:70848750-70848772 AAGGTACATGAGGCCAGGTGTGG - Intronic
1069927529 10:71861209-71861231 CAGCTACAGGAGGCTTAGGTGGG + Intergenic
1071589927 10:86863089-86863111 CAGCTACTTGAGGCCGAGGTAGG - Intronic
1071977845 10:90973164-90973186 GAGGTACATGAGGCCTTTTAAGG - Intergenic
1079997483 11:27309875-27309897 CAGGTTCATGGTGTCTAGTTAGG - Intergenic
1084381897 11:68817921-68817943 CAAGGACAGGGGGCCTAGTTTGG + Intronic
1085685349 11:78616738-78616760 AAGGTAAATGAGGCCAAGCTTGG - Intergenic
1089006655 11:115097268-115097290 CAGGTCCATGAGGCCTCATCTGG + Intergenic
1091858254 12:3756184-3756206 CAGGGACATGAGTCCTGGGTTGG - Intronic
1093955052 12:25207265-25207287 CAGGTTTATGAGGCCAAGGTGGG + Intronic
1095206892 12:39448467-39448489 CAGGTACATGCTACCAAGTTAGG - Intergenic
1098178679 12:67821468-67821490 CAGGTACATGGAGACTATTTGGG - Intergenic
1101247300 12:102896179-102896201 CAGGCACATGGGGCCTCATTGGG + Intronic
1103276779 12:119718461-119718483 CAGGGACATTCGGCTTAGTTTGG - Intronic
1103461508 12:121108369-121108391 CAGTTCCAAGAGGCCTAGCTTGG + Intergenic
1105251036 13:18698429-18698451 CAGGTCCCTGAGGCCCAGCTTGG + Intergenic
1105543978 13:21338685-21338707 CAGGTACATGGGCCCTGCTTGGG - Intergenic
1106889522 13:34228359-34228381 TATGTACATGAGGGCTAGGTGGG - Intergenic
1112944981 13:104917403-104917425 CAGTTGCATGAGGTCAAGTTAGG - Intergenic
1114035128 14:18617445-18617467 CTGGTACATGAGGCCCAGTGTGG + Intergenic
1114123517 14:19697571-19697593 CTGGTACATGAGGCCCAGTGTGG - Intergenic
1114731390 14:24996378-24996400 CAGGTATAGGAAGCCCAGTTAGG - Intronic
1117386649 14:55221022-55221044 CAGTTACATCAGGCCTGGTGCGG + Intergenic
1118959929 14:70519812-70519834 TTGGTACAAGAGGCCTAGCTTGG - Intergenic
1120763983 14:88311696-88311718 TAGGTGCATGAGGCTTAGTCTGG + Intronic
1129132974 15:73517385-73517407 AAGATACATGAAGCCTACTTAGG + Intronic
1132080624 15:98861816-98861838 TAGGTACATGTGCCCTATTTAGG - Intronic
1139512035 16:67432991-67433013 CAGGTACTAGTGGCCTAGCTGGG + Intronic
1141664370 16:85458331-85458353 CAGGTAAATGAGGCCCTGCTTGG + Intergenic
1144487323 17:15677731-15677753 AAGTTACATGAGGCATACTTAGG + Intronic
1146998503 17:37342592-37342614 CAGGAACATAAGGCACAGTTTGG - Intronic
1149418848 17:56488762-56488784 CTGGGCCATGTGGCCTAGTTTGG - Intronic
1151595265 17:75074509-75074531 CAGGGACAGGATGCCTAGGTGGG + Intergenic
1152756838 17:82090547-82090569 CAGGTCTATGAGGCCTATCTGGG + Exonic
1152778194 17:82214916-82214938 CAGCTACCTGAGGCCAAGGTGGG + Intergenic
1152778440 17:82215994-82216016 CAGCTACCTGAGGCCAAGGTGGG - Intergenic
1153666568 18:7371774-7371796 CAGGTGGGTGAGGCCTAGCTTGG + Intergenic
1158346077 18:56518373-56518395 CGGGTGGATGAGGACTAGTTGGG - Intergenic
1158521126 18:58172030-58172052 GGGGTACATGAGGCCCAGCTGGG + Intronic
1159395521 18:67850588-67850610 CAGGTACATTTGCCCTATTTTGG - Intergenic
1159467168 18:68798602-68798624 AAGGTACATGAGGCATAGATAGG - Intronic
1160553040 18:79707253-79707275 CACGTTCATGAGGCCTCGTGTGG + Intronic
1161944956 19:7429701-7429723 CAGGGACATGAGCCCCAGCTTGG - Intronic
1163595430 19:18218579-18218601 CAGGTGCTTGAGGCATAGATAGG - Intronic
1163596626 19:18224670-18224692 CGGCTACATGAGGGCTAGTTCGG + Intronic
1164702022 19:30292215-30292237 CAGGTACATGTGTCCTGGTTAGG - Intronic
1166370439 19:42297371-42297393 CAGGAACACGAGGCGTAGTAAGG + Intronic
1168301812 19:55409052-55409074 CAGGTACCTGTGGCCAAATTAGG - Intergenic
927934381 2:27067702-27067724 CAGGTTCTTTAAGCCTAGTTGGG + Intronic
928812792 2:35249230-35249252 CAGGAAGATGAGGGCAAGTTTGG - Intergenic
929543979 2:42843793-42843815 CAGGTACATGAGGAGCAGTGAGG + Intergenic
929611552 2:43274483-43274505 TAAGTTCATGAGGGCTAGTTGGG + Intronic
931550522 2:63440859-63440881 CTGGGACATGATGCCTAGGTGGG - Intronic
932403886 2:71500759-71500781 CTGGTCCATGAGGCCTCCTTGGG + Intronic
934072073 2:88393569-88393591 CAGGAAGATGAGGGCAAGTTTGG + Intergenic
936666590 2:114603966-114603988 AAGGTACATGGGGCAAAGTTTGG + Intronic
938276123 2:130025423-130025445 CTGGTACATGAGGCCCCGTGTGG - Intergenic
938327078 2:130416180-130416202 CTGGTACATGAGGCCCCGTGTGG - Intergenic
938362861 2:130705297-130705319 CTGGTACATGAGGCCCCGTGTGG + Intergenic
938439249 2:131311926-131311948 CTGGTACATGAGGCCCCGTGTGG + Intronic
941786088 2:169500177-169500199 CAGGTACATGAGCTCTCTTTTGG + Intronic
947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG + Intergenic
948775230 2:240284529-240284551 CAGCTCCCTGAGGCCTGGTTTGG - Intergenic
948893350 2:240917380-240917402 CAGGTGCAGGAGGCCTGGCTGGG + Intergenic
1170117376 20:12874964-12874986 CAGGTAGAGGTGGCCTAGTAAGG + Intergenic
1172909689 20:38398870-38398892 CAGGCACATGAGGCCTGTTCTGG - Intergenic
1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG + Intergenic
1176695903 21:9977825-9977847 CAGGAAAATGTGGCCAAGTTTGG + Intergenic
1178558078 21:33611311-33611333 AACGTACATGAAGCCTAGTGAGG - Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1180459249 22:15544492-15544514 CTGGTACATGAGGCCCAGTGTGG + Intergenic
1184599204 22:45532694-45532716 CAGGTACATGAGGCCTAGTTGGG + Intronic
949771944 3:7588555-7588577 CATGTACATGAGACTTAGATGGG - Intronic
950041093 3:9919965-9919987 CAGGTACATGTGGCCTCCTAAGG - Intronic
950518467 3:13482100-13482122 CAGTTACAAGAGGCGGAGTTGGG + Intronic
953505322 3:43480581-43480603 CAGGTTCATGAGAGATAGTTTGG - Intronic
955647113 3:61151708-61151730 CAGGCACATGCGGCCAAGCTTGG + Intronic
956101480 3:65772733-65772755 CAGGTAAATGAGTCTAAGTTTGG + Intronic
956141591 3:66151751-66151773 GAGGTACATGAGGCCTGATCAGG - Intronic
957469099 3:80635465-80635487 TTGGTACAAGAGGCTTAGTTTGG + Intergenic
958000551 3:87743515-87743537 CAGCTACATGAGGACTCATTGGG - Intergenic
961552672 3:127678006-127678028 CAGGTAGAGGAAGCCTTGTTGGG + Intronic
966661946 3:182424642-182424664 GAGGTACTTGTGGCCTAATTGGG - Intergenic
973564811 4:52173823-52173845 CAGGAAATTGAGGCCTAGTGAGG + Intergenic
974625742 4:64427381-64427403 CAGTTACAGGAGGCCGAGGTGGG - Intergenic
977604689 4:98971778-98971800 CAGCTACATGAGGCTGAGTCAGG - Intergenic
980368520 4:131838065-131838087 CAGGAAAATGTGGCCAAGTTTGG + Intergenic
987289795 5:16497769-16497791 TAGGATCATGAGGCCTTGTTGGG - Intronic
989468825 5:41791114-41791136 CAAGTCCATGAGGTTTAGTTTGG - Intronic
990433623 5:55764702-55764724 CAGAGACATGAAGCCAAGTTTGG - Intronic
993608261 5:90021553-90021575 CAGAGACATGAGGCCAAATTTGG + Intergenic
994019199 5:95003948-95003970 CAGGAACATGAGGAAAAGTTTGG + Intronic
996783114 5:127210104-127210126 CAGGAACATGTGGCACAGTTTGG + Intergenic
999267773 5:150278184-150278206 CAAGCACATGAGACATAGTTGGG + Intronic
999373624 5:151071386-151071408 TAGGTAACTGAGGCCTAGTGAGG - Intronic
1001557734 5:172647828-172647850 CAGGAGCCTGAGTCCTAGTTGGG - Intronic
1003166403 6:3682678-3682700 CAGGGTCAGGAGGCCTAGTCAGG - Intergenic
1004413902 6:15406967-15406989 AAGGTACATGAGGCCATGTGCGG + Intronic
1011563534 6:88648561-88648583 GGGGTACAAGAGGCATAGTTGGG - Intronic
1013091018 6:106900963-106900985 CAGGAACATGAGGGAAAGTTTGG + Intergenic
1014725874 6:124971365-124971387 CAAGTAGATGAGGCTGAGTTTGG - Intronic
1015714664 6:136180233-136180255 CAGGGACTAGAAGCCTAGTTTGG - Intronic
1021596194 7:22319584-22319606 ATGGTACATGAGGCCTAGGCGGG - Intronic
1025759216 7:64374604-64374626 CAGGTACAAGAGTCCTTATTAGG - Intergenic
1026623075 7:71968398-71968420 AAGGTACATGAGGCCTTCTTTGG + Intronic
1029149679 7:98470886-98470908 CAGGTACGTGTGGCCAAGTGTGG + Intergenic
1029645878 7:101855434-101855456 AAGGAAAATGAGGCCTAGGTAGG + Intronic
1032241540 7:130163017-130163039 TAGGTGCATGAGGCCAGGTTGGG + Intergenic
1034336205 7:150325092-150325114 CAGGTCCATGTGGGCTATTTTGG - Intronic
1047923478 8:129658547-129658569 CAGGAACATGAGGGAAAGTTTGG - Intergenic
1051818390 9:21135755-21135777 CAGATAAATGAGGCCCAGTGAGG + Intergenic
1053397619 9:37788491-37788513 CAGGTACATGAGACTGAATTTGG + Intronic
1053632884 9:39963777-39963799 CAGGAAAATGTGGCCAAGTTTGG + Intergenic
1053772872 9:41499756-41499778 CAGGAAAATGTGGCCAAGTTTGG - Intergenic
1054211004 9:62286920-62286942 CAGGAAAATGTGGCCAAGTTTGG - Intergenic
1054313979 9:63561934-63561956 CAGGAAAATGTGGCCAAGTTTGG + Intergenic
1057956258 9:99410485-99410507 CAGGTACATCAGTCTGAGTTGGG - Intergenic
1059173249 9:112146494-112146516 CAGGCAGATTAGGTCTAGTTCGG + Intronic
1060268434 9:122125677-122125699 CAAGTACCTGAGGCCCAGTCTGG - Intergenic
1062324007 9:136003956-136003978 CAGGTAGAGGAGGCCTAGGGTGG - Intergenic
1188313975 X:28651001-28651023 CAGTCACATGAGGCCAAGTATGG - Intronic
1189295798 X:39916703-39916725 AAGGTTCATGAGGCTTAGTGAGG - Intergenic
1190759638 X:53428652-53428674 CAGAGACCTGAGGCCTAGTGGGG + Intronic
1192153674 X:68727327-68727349 CAGGGAAATGAAGCCTACTTGGG - Intergenic
1194471774 X:94305652-94305674 CAGGAACATGAGGGAAAGTTTGG - Intergenic