ID: 1184600452

View in Genome Browser
Species Human (GRCh38)
Location 22:45540271-45540293
Sequence GGCAGTAATGATAGTGATAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184600446_1184600452 25 Left 1184600446 22:45540223-45540245 CCAGAGTCATTCAGTCTCCGGAC No data
Right 1184600452 22:45540271-45540293 GGCAGTAATGATAGTGATACCGG No data
1184600451_1184600452 -6 Left 1184600451 22:45540254-45540276 CCTGTTTATAAAGTGCAGGCAGT No data
Right 1184600452 22:45540271-45540293 GGCAGTAATGATAGTGATACCGG No data
1184600449_1184600452 3 Left 1184600449 22:45540245-45540267 CCTTGGTTTCCTGTTTATAAAGT No data
Right 1184600452 22:45540271-45540293 GGCAGTAATGATAGTGATACCGG No data
1184600445_1184600452 26 Left 1184600445 22:45540222-45540244 CCCAGAGTCATTCAGTCTCCGGA No data
Right 1184600452 22:45540271-45540293 GGCAGTAATGATAGTGATACCGG No data
1184600448_1184600452 8 Left 1184600448 22:45540240-45540262 CCGGACCTTGGTTTCCTGTTTAT No data
Right 1184600452 22:45540271-45540293 GGCAGTAATGATAGTGATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184600452 Original CRISPR GGCAGTAATGATAGTGATAC CGG Intronic