ID: 1184602339

View in Genome Browser
Species Human (GRCh38)
Location 22:45551079-45551101
Sequence GTCCAGCCTGGTGACCGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184602332_1184602339 22 Left 1184602332 22:45551034-45551056 CCTGTTGGACGTTGTTGTTAGGT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1184602339 22:45551079-45551101 GTCCAGCCTGGTGACCGTGTGGG 0: 1
1: 0
2: 3
3: 32
4: 225
1184602333_1184602339 -2 Left 1184602333 22:45551058-45551080 CCCACCTGAAAGCCAGAATTCGT 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1184602339 22:45551079-45551101 GTCCAGCCTGGTGACCGTGTGGG 0: 1
1: 0
2: 3
3: 32
4: 225
1184602334_1184602339 -3 Left 1184602334 22:45551059-45551081 CCACCTGAAAGCCAGAATTCGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1184602339 22:45551079-45551101 GTCCAGCCTGGTGACCGTGTGGG 0: 1
1: 0
2: 3
3: 32
4: 225
1184602335_1184602339 -6 Left 1184602335 22:45551062-45551084 CCTGAAAGCCAGAATTCGTCCAG 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1184602339 22:45551079-45551101 GTCCAGCCTGGTGACCGTGTGGG 0: 1
1: 0
2: 3
3: 32
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184602339 Original CRISPR GTCCAGCCTGGTGACCGTGT GGG Intronic
900381515 1:2386459-2386481 CTCCAGCCTGGTGACAGAGCGGG - Intronic
900526055 1:3129304-3129326 GTCCTGCCTGGTGTGTGTGTGGG + Intronic
900657503 1:3766870-3766892 CTCCAGCCTGGTGACGGAGCAGG - Intronic
900945238 1:5827516-5827538 GCCCAGCCTGGTGACCGTCTAGG - Intergenic
901936267 1:12629324-12629346 TTCCAGCCTGGGGACTGTTTGGG + Intergenic
903380424 1:22892924-22892946 GCCCTGCACGGTGACCGTGTTGG - Exonic
903570229 1:24298659-24298681 CTCCAGCCTGGTAACAGAGTGGG + Intergenic
905059339 1:35125954-35125976 CTGCAGCCTGGTGACAGAGTGGG - Intergenic
907042827 1:51278671-51278693 CTCCAGCCTGGTGACAGAGTGGG + Intergenic
907154411 1:52319979-52320001 CTCCAGCCTGGTGACAGAGAGGG + Intronic
907170325 1:52457265-52457287 CTCCAGCCTGGTGACAGAGAGGG - Intronic
907216867 1:52871525-52871547 TTCCAGCCTGGTGACAGAGTGGG - Intronic
907284542 1:53371315-53371337 CTCCAGGCTGATAACCGTGTGGG - Intergenic
911177264 1:94829249-94829271 CTCCAGCCTGGTGACAGAGCGGG + Intronic
912350636 1:109009051-109009073 CTCCAGCCTGGTGACAGAGCGGG + Intronic
912358824 1:109077387-109077409 CTCCAGCCTGGTGACAGAGCGGG + Intergenic
916060417 1:161094537-161094559 CTCCAGCCTGGTGACAGAGCAGG + Intergenic
916092724 1:161320856-161320878 CTCCAGCCTGGTGACAGAGCGGG - Intronic
916535419 1:165698754-165698776 TTCCCGCCTGGAGACTGTGTGGG - Exonic
919774932 1:201188365-201188387 CTCCAGCCTGGTGACAGAGTGGG - Intergenic
920222328 1:204412734-204412756 CTCCAGCCTGGCGACAGAGTGGG - Intergenic
921768320 1:219001052-219001074 CTCCAGCCTGGTGACAGAGCGGG - Intergenic
922572232 1:226640956-226640978 GTCCAGCCTGGAGTCAGGGTTGG - Intronic
922874813 1:228932199-228932221 GGCCAGCCTAGTGACCCTCTTGG + Intergenic
923501474 1:234568879-234568901 CTCCAGCCTGGTGACAGAGCAGG - Intergenic
924721356 1:246626079-246626101 CTCCAGCCTGGTGACAGAGTGGG - Intronic
924734054 1:246738477-246738499 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1063479463 10:6361558-6361580 GTCCTGCCTGGTGCCTGAGTGGG + Intergenic
1064209310 10:13349373-13349395 CTCCAGCCTGGCGACAGAGTGGG - Intergenic
1064297458 10:14091463-14091485 GTCCAGCCTGGTGACAGAGTGGG - Intronic
1064319806 10:14294390-14294412 GTCAAGCCTTGTGAACGTGGAGG - Intronic
1064614431 10:17137865-17137887 GTCCAGCAGGGTGACCTTGAAGG + Intergenic
1065631046 10:27681415-27681437 CTCCAGCCTGGTGACAGAGCAGG + Intronic
1067357371 10:45542313-45542335 CTCCAGCCTGGTGACAGAGCAGG + Intronic
1069211993 10:65773293-65773315 CTCCAGCCTGGTGACAGATTGGG - Intergenic
1070197547 10:74172872-74172894 CTCCAGCTTGGTGACAGAGTGGG + Intronic
1070602136 10:77873415-77873437 AGCCAGCCTGGTGACCCTCTGGG + Intronic
1071073016 10:81715802-81715824 CTCCAGCCTGGGGACAGAGTAGG + Intergenic
1071490894 10:86135625-86135647 GGCCTGCCTGGGGACCCTGTGGG - Intronic
1074699667 10:116082179-116082201 GTCCAGCCTGGTGACCAGAGTGG - Intronic
1075142833 10:119854920-119854942 CTCCAGCCTGGTGACAGAGCAGG + Intronic
1075638356 10:124046110-124046132 GGCACGCCTGGTGACCGTGATGG + Exonic
1078798033 11:14613281-14613303 GTCCAGCCTGGGCACCATCTCGG - Intronic
1079218357 11:18536100-18536122 CTCCAGCCTGGTGACAGAGTGGG + Intronic
1080314649 11:30935583-30935605 CTCCAGCCTGGTGACAGGGTGGG - Intronic
1080692214 11:34567542-34567564 GTGCACCCTTGTGAACGTGTCGG - Intergenic
1081812993 11:45923556-45923578 GTACAGCCAGGTGTCCGTGGAGG + Intronic
1084420977 11:69060430-69060452 CTCCAGCCTTGTGGCCGAGTGGG + Intronic
1084451272 11:69240221-69240243 CTCCAGCCTGGTGACAGAGTAGG + Intergenic
1084752464 11:71213253-71213275 GTGCAGGCTGCTGGCCGTGTGGG - Intronic
1085202790 11:74711839-74711861 CTCCAGCCTGGTGACAGAGCAGG - Intronic
1085608946 11:77928987-77929009 CTCCATCCTGGTGACAGAGTGGG + Intronic
1092907615 12:13116304-13116326 GCCCAGGCTGGTGTCCCTGTGGG - Intronic
1093840490 12:23893412-23893434 CTCCAGCCTGGTGACAGGGCGGG + Intronic
1094680520 12:32663178-32663200 CTCCAGCCTGGTGACAGAGCGGG - Intergenic
1095714008 12:45321999-45322021 GTCCAGTCTGGTGCCAATGTGGG + Intronic
1095884794 12:47177596-47177618 GTCCAGCCTGGTGGTGGGGTGGG + Intronic
1097060849 12:56282540-56282562 GTCCAGCATGGTGACCACATGGG + Exonic
1102120691 12:110438565-110438587 CTCCAGCCTGGTGACAGAGCGGG + Intronic
1102734932 12:115151088-115151110 CTCCAGCCTGGCGACAGAGTAGG - Intergenic
1104969123 12:132523252-132523274 GTCCTGCCTGGGGACAGAGTGGG + Intronic
1105057708 12:133117976-133117998 CTCCAGCCTGGTGACAGAGCAGG - Exonic
1106349194 13:28911205-28911227 TTCCAGCCTGGTGACAGAGCAGG - Intronic
1106820625 13:33460457-33460479 CTCCAGCCTGGTGACAGAGCAGG + Intergenic
1108988051 13:56619048-56619070 CTCCAGCCTGGTGACAGAGCGGG + Intergenic
1109881918 13:68489586-68489608 CTCCAGCCTGGTAACAGAGTGGG + Intergenic
1110265083 13:73528667-73528689 CTCCAGCCTGGTGACAGAGCGGG - Intergenic
1112622476 13:101066276-101066298 TTCCAGCCTGGAGACAGAGTGGG + Intronic
1112730632 13:102357181-102357203 GTGCAACCTGGTGTCCTTGTTGG - Intronic
1113407910 13:110058728-110058750 GTCCAGAGTGGTGAGCTTGTAGG + Intergenic
1115279122 14:31640981-31641003 CTCCAGCCTGGTGACAGAGTGGG - Intronic
1115564798 14:34615985-34616007 CTCCAGCCTGGTGACAGGGCGGG - Intronic
1115700236 14:35946318-35946340 CTCCAGCCTGGTGACAGAGCAGG - Intergenic
1117056028 14:51912678-51912700 ATCCAGGCTGGTAACCTTGTAGG - Intronic
1117395508 14:55305381-55305403 CTCCAGCCTGGTGACAGAGTGGG + Intronic
1118823431 14:69359991-69360013 CTCCAGCCTGGCGACGGAGTGGG + Intergenic
1119529381 14:75348937-75348959 CTCCAGCCTGGTGACAGAGCAGG - Intergenic
1121967820 14:98326714-98326736 TTCCAGCCTGGTGACAGAGTAGG + Intergenic
1122365234 14:101191243-101191265 CTCCAGCATGGAGACAGTGTCGG - Intergenic
1122929347 14:104926257-104926279 GGCCAGCCAGGTGACCATGCTGG + Intronic
1123771245 15:23531633-23531655 CTCCAGCCTGGCGACAGAGTGGG - Intergenic
1124110872 15:26785103-26785125 TTCCAGCCTGATGACAGAGTGGG + Intronic
1125326994 15:38546247-38546269 CTCCAGCCTGGTGACAGAGCGGG - Intronic
1131829959 15:96347813-96347835 GCCTAGCCGGGCGACCGTGTTGG - Intergenic
1132014390 15:98302854-98302876 CTCCAGCCTGGTGACAGAGCGGG + Intergenic
1132323643 15:100946999-100947021 CTCCAGCCTGGTGACAGAGCAGG - Intronic
1132508858 16:326711-326733 CTCCAGCCTGGTGACAGAGTGGG + Intronic
1132999155 16:2840549-2840571 GTCCAGGATTGTGCCCGTGTTGG - Intergenic
1135110756 16:19689068-19689090 CTCCAGCCTGGCGACAGAGTGGG - Intronic
1135292241 16:21249952-21249974 CTTCAGCCTGGTGACCTTCTTGG - Exonic
1136168698 16:28474233-28474255 CTCCAGCCTGGTGACAGAGCAGG + Intergenic
1136231324 16:28887308-28887330 GTCAAGCCAGGTGCCCGGGTTGG + Intronic
1137298388 16:47120937-47120959 CTCCAGCCTTGTTACCATGTCGG - Intronic
1138570649 16:57869905-57869927 GACCAGCCTGGTCACCATGGTGG + Intergenic
1140354537 16:74293985-74294007 CTCCAGCCCGGTGACAGAGTAGG + Intergenic
1141596493 16:85100126-85100148 CGCCAGCCAGGTGAGCGTGTGGG - Exonic
1141614390 16:85202336-85202358 GCCCACCCTGGAGGCCGTGTGGG - Intergenic
1141875774 16:86823237-86823259 CTCCATGCTGGGGACCGTGTGGG - Intergenic
1142613677 17:1123219-1123241 GTCCAGCCTGGGGATCGTCCGGG - Intronic
1142957885 17:3533528-3533550 CTCCAGCCTGGCGACAGAGTAGG - Intronic
1144013717 17:11173978-11174000 CTCCAGCCTGGCGACAGAGTGGG + Intergenic
1145992489 17:29087420-29087442 GTACAGCCTGGTGGGCCTGTCGG + Intronic
1147166877 17:38598214-38598236 GGCCAGCCTGGTCACTGGGTGGG + Intronic
1149549114 17:57526942-57526964 CTCCACCCTGGTGAGCGTGGGGG - Intronic
1149561606 17:57611523-57611545 GGCCAGCCTAGAGTCCGTGTGGG - Intronic
1150045478 17:61909141-61909163 CTCCAGCCTGGTGACAGAGCAGG - Intronic
1151370510 17:73644082-73644104 CTCCAGGCTGGTCACCATGTGGG - Exonic
1151500177 17:74483387-74483409 CTCCAGCCTGGCGACAGAGTGGG - Intronic
1151597131 17:75085252-75085274 CTCCAGCCTGGTGACGGAGCAGG + Intergenic
1152687156 17:81700335-81700357 CTCCAGCCTGGTGACAGAGCAGG + Intronic
1152822862 17:82446030-82446052 GTCCACCCTGGTGAGGGTGGGGG - Intronic
1153782645 18:8507605-8507627 GTCCAGCCTGGACAACGTGCCGG + Intergenic
1154105593 18:11519927-11519949 CTCCAGCCTGGTGACAGAGCAGG - Intergenic
1154173083 18:12064394-12064416 GTCCTCCCTGCTGACCCTGTGGG + Intergenic
1155452947 18:25981836-25981858 CTCCAGCCTGGTGACAGAGCGGG + Intergenic
1157234878 18:45955016-45955038 GTCCACCCTGGAGACAATGTTGG - Exonic
1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG + Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1162276237 19:9657576-9657598 CTCCAGCCTGGTGACAGAGTGGG - Intronic
1162555982 19:11385853-11385875 CTCCAGCCTGGTGACAGAGCGGG + Intronic
1162984669 19:14261957-14261979 CTCCAGCCTGGTGACATAGTAGG - Intergenic
1163562900 19:18031074-18031096 GTCCAGCATGGTGACCACATGGG - Intergenic
1163754500 19:19098562-19098584 CTCCAGCCTGGTGGCAGAGTGGG + Intronic
1165696512 19:37905198-37905220 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1167281717 19:48573123-48573145 CTCCAGCCTGGTGACAGAGCAGG + Intronic
1168572318 19:57481667-57481689 CTCCAGCCTGGTGACAGAGTGGG + Intergenic
925188984 2:1867996-1868018 CTCCAGCCTGGTGACAGAGCAGG - Intronic
931024045 2:58087953-58087975 CTCCAGCCTGGTGACAGAGCGGG + Intronic
931320659 2:61172130-61172152 CTCCAGCCTGGTGACAGAGCGGG + Intergenic
931365384 2:61614621-61614643 GGCCAGCCTGGTCAACATGTTGG - Intergenic
932374149 2:71220203-71220225 TTTCAGCCTAGTGACCATGTGGG - Intronic
933773774 2:85759574-85759596 GTCCAGCCTGGTGGCAGTGCAGG + Intronic
934717469 2:96552024-96552046 GTGCAGCATGGTGCCCCTGTAGG - Exonic
935361508 2:102250351-102250373 CTGTAGCCTGGAGACCGTGTGGG - Intergenic
936797787 2:116227476-116227498 CTCCAGCCTGGTGACGGAGCGGG + Intergenic
937103019 2:119286192-119286214 CTCCAGCCTGGTGACAGAGCAGG + Intergenic
939211686 2:139183637-139183659 ACCCAGCCTGGTGACAGAGTGGG - Intergenic
941585883 2:167358832-167358854 CTCCAGCCTGGTGACAGAGCAGG - Intergenic
942500154 2:176580658-176580680 GTGAAGCCTGGTGACAGAGTGGG - Intergenic
944810169 2:203319856-203319878 CTCCAGCCTGGCGACAGAGTGGG + Intergenic
945101807 2:206269243-206269265 TTCCAGCCTGGTGACAGAGTGGG + Intergenic
947551452 2:231049579-231049601 CTCCAGCCGGGTGACAGTCTGGG + Exonic
1169449348 20:5697971-5697993 CTCCAGCCTGGTGACAGAGCGGG + Intergenic
1169972244 20:11280393-11280415 GTCCAGCCTGGTGACAGAGTGGG + Intergenic
1170603637 20:17860048-17860070 GTCCAGCCTGGGGAAAGAGTGGG - Intergenic
1170749355 20:19131446-19131468 GTCTTCCCTGGTGACCGTCTTGG - Intergenic
1171465437 20:25324660-25324682 GTCCAGCCTGGTGACATTTGAGG - Intronic
1174605232 20:51756613-51756635 ATCCAGCCCGGTGACCTTATAGG - Intronic
1175206821 20:57317553-57317575 GACCATCCTGGCCACCGTGTGGG + Intergenic
1175908016 20:62391398-62391420 GTGCAGCCTGGAGCCCGTGACGG - Exonic
1180797378 22:18612681-18612703 CTCCAGCCTGGCGACAGAGTGGG - Intergenic
1181273553 22:21674667-21674689 CTCCAGCCTGGTGACAGAGAGGG + Intronic
1181282951 22:21732748-21732770 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1182596144 22:31422077-31422099 CTCCAGCCTGGTGACAGAGCGGG + Intronic
1183186443 22:36294092-36294114 CTGCAGCTTGGTGACCTTGTCGG + Exonic
1183308174 22:37094968-37094990 GTGCAGCGTGGTGACTGTGCTGG + Intronic
1183325929 22:37194102-37194124 GTTTAACCTTGTGACCGTGTGGG - Intronic
1183730676 22:39616933-39616955 GTGGAGCCTGGTGGCCGTGTAGG + Intronic
1184574344 22:45350307-45350329 CTCCAGCCTGGTGACAGAGCGGG - Intronic
1184602339 22:45551079-45551101 GTCCAGCCTGGTGACCGTGTGGG + Intronic
1184905852 22:47486047-47486069 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1185076255 22:48684484-48684506 GTCCAGCCTCGTGAACGGGAAGG - Intronic
951361924 3:21735552-21735574 CCCCATCCTGGTGACTGTGTAGG - Intronic
954035326 3:47848182-47848204 GTCCTGCCTGGAGACAGTGTGGG + Exonic
954749815 3:52807115-52807137 GTCCACCTTGGAGACCTTGTAGG - Intronic
954887239 3:53886266-53886288 CTCCAGCCTGGAGACAGAGTGGG - Intronic
956872919 3:73435777-73435799 GACCAGCCTGGCAACTGTGTAGG - Intronic
958555366 3:95668484-95668506 CTCCAGCCTGGCGACCGAGCGGG - Intergenic
958948062 3:100387247-100387269 GACCAGCCTGGGCAACGTGTCGG + Intronic
959294920 3:104522766-104522788 CTCCAGCCTGGCGACAGAGTAGG + Intergenic
959521677 3:107328729-107328751 GTCCAGCATGGTGACCACATGGG + Intergenic
961008455 3:123420553-123420575 GTCCAGGCTCTTGGCCGTGTAGG - Intronic
961663148 3:128481024-128481046 GTCCAGCATGGTGACCGCCATGG - Exonic
964751011 3:160053913-160053935 CTCCAGCCTGGTGACAGAGCAGG + Intergenic
966991258 3:185233675-185233697 CTCCAGCCTGGTGACAGAGCGGG - Intronic
966993057 3:185253909-185253931 CTCCAGCCCGGGGACCGTGCGGG - Intronic
968072798 3:195797235-195797257 CTCCAGCCTGGTGACAGAGCAGG + Intronic
968409609 4:378298-378320 CTCCAGCCTGGTGACAGAGTGGG - Intronic
968496040 4:916288-916310 CTCCATCCTGGTGACAGAGTAGG - Intronic
968914875 4:3493047-3493069 GTCCAGGCTGCTGCCCGCGTAGG - Exonic
969728635 4:8940266-8940288 GTCCAACCTGGAAACCTTGTAGG + Intergenic
973254632 4:48097448-48097470 CTCCAGCCTGGCGACAGAGTGGG - Intronic
976344691 4:83986689-83986711 TTCCAACCTGGAGACTGTGTAGG - Intergenic
978521444 4:109619673-109619695 CTCCAGCCTGGTGACTGGGTGGG + Intronic
979329774 4:119411232-119411254 GTCCAGCCTGGTGACAGAGCAGG + Intergenic
979686636 4:123517668-123517690 CTCCAGCCTGGTGACAGAGCGGG - Intergenic
980608558 4:135125427-135125449 CTCCAGCCTGGTGACAGAGCGGG + Intergenic
983554730 4:169049910-169049932 CTCCAGCCTGGTGACACTTTGGG + Intergenic
985672578 5:1213966-1213988 GTCCAGCCAGGTGTCCGGCTGGG - Exonic
990287146 5:54311138-54311160 TTCCAGCCTGGTGTCCCTGAGGG + Intergenic
991698764 5:69298045-69298067 CTCCAGCCTGGTGACAGAGCGGG - Intronic
993510417 5:88764384-88764406 CTCCTGCCTGGAGACAGTGTGGG + Intronic
998140914 5:139698945-139698967 GCCCAGCCTGGTGAAAATGTTGG + Intergenic
1002351024 5:178583800-178583822 GTCCAGGCTAGTGTCTGTGTAGG - Intronic
1003183378 6:3810664-3810686 GTCCATCCTGGGAACCGTGATGG - Intergenic
1003264126 6:4550781-4550803 GTCCTGCCTGGTAGGCGTGTGGG - Intergenic
1003901222 6:10657559-10657581 CTCCAGCCTGGTGACAGAGCAGG + Intergenic
1004412673 6:15395694-15395716 CTCCAGCCTGGTGACAGAGCTGG - Intronic
1004710693 6:18167323-18167345 CTCCAGCCTGGTGACAGAGTGGG + Intronic
1006972913 6:38065281-38065303 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1007360841 6:41354048-41354070 CTCCAGCCTGGTGATAGAGTGGG + Intergenic
1007624692 6:43238025-43238047 CTGCAGCCTGGTAACCTTGTAGG - Intergenic
1009694791 6:67088445-67088467 GACCAGCCTGGTCAACGTGGCGG - Intergenic
1012186738 6:96226424-96226446 TTCCAGCCTGGTGACAGAGCGGG + Intergenic
1014333083 6:120095744-120095766 CTCCACCCTGCTGACCTTGTAGG - Intergenic
1015947700 6:138520318-138520340 CTCCAGCCTGGTGACAGAGCGGG - Intronic
1016426984 6:143945505-143945527 CTTCAGCCTGGTGACAGGGTGGG - Intronic
1017307422 6:152935469-152935491 CTCCAGCCTGGTGACAAAGTGGG - Intergenic
1017983959 6:159426295-159426317 GGGCAGCCTGGAGACCCTGTGGG - Intergenic
1018166614 6:161103887-161103909 GACAAGCCTGGTGACAGAGTAGG + Intronic
1018430420 6:163717440-163717462 CTCCAGCCTGGGGACACTGTGGG - Intergenic
1019452409 7:1106607-1106629 GTGCAGCCTGGTGAGGGTGACGG + Intronic
1019750655 7:2727111-2727133 CTCCAGCCTGGTGACAGAGTGGG - Intronic
1019766170 7:2852293-2852315 CTCCAGCCTGGTGACACAGTGGG + Intergenic
1022735640 7:33073305-33073327 CTCTATCCTGGTGACAGTGTGGG + Intergenic
1022775033 7:33518280-33518302 CTCCAGCCTGGCGACAGGGTGGG - Intronic
1026143318 7:67724425-67724447 CTCCAGCCTGGTGACAGAGCAGG + Intergenic
1026217212 7:68360248-68360270 CTCCAGCCTGGTGACAGAGAGGG - Intergenic
1027241761 7:76335087-76335109 CTCCAGCCTGGTGACAGAGTGGG - Intronic
1027621741 7:80495499-80495521 CTCCAGCCTGGTGACAGAGTGGG - Intronic
1030558416 7:111055234-111055256 GACCAGCCTGGTGAACGTTGCGG - Intronic
1031417618 7:121511643-121511665 CTCCAGTCTGGTGACAGAGTGGG - Intergenic
1037245979 8:16835202-16835224 CTCCAGCTTGGTGACAGAGTGGG + Intergenic
1037799043 8:22021877-22021899 CTCCAGCCTGGTGACAGAGCGGG + Intergenic
1037988299 8:23303205-23303227 CTCCAGCCAGGTGATCGTGGAGG + Intronic
1040482098 8:47835588-47835610 CTCCAGCCTGGTGACAGAGCAGG + Intronic
1042572441 8:70180725-70180747 CTCCAGCCTGGTGACATAGTGGG - Intronic
1042752595 8:72174600-72174622 CTCCAGCCTGGTGACAGAGTGGG - Intergenic
1044992655 8:97809955-97809977 CTCCAGCCTGGTGACAGAGTGGG - Intronic
1045322187 8:101090761-101090783 GTCCAGGCTGGAGACAGTGGTGG + Intergenic
1045620849 8:103976577-103976599 CTCCAGCCTGGTGACAGAGCAGG - Intronic
1045728383 8:105203401-105203423 CTCCAGCCTGGGGACAGAGTGGG - Intronic
1045959881 8:107954640-107954662 CTCCAGCCTGGTGACAGAGCAGG - Intronic
1046890059 8:119412960-119412982 CTCCAGCCTGGTGACAGAGAGGG + Intergenic
1046944912 8:119965401-119965423 ATCCAGCATGGTGAGCGTATTGG + Exonic
1049619160 8:143590039-143590061 CTGCACCCTGGAGACCGTGTGGG - Exonic
1049644986 8:143732158-143732180 GTCCTGCCTGGTGCCCCTGGGGG + Intronic
1049683884 8:143931555-143931577 CTCCAGCCGGGTGACGGTGGCGG + Exonic
1049758476 8:144321203-144321225 GTCCAGGCTGGAGCCCCTGTGGG - Intronic
1050816723 9:9822377-9822399 TTCCAGCCTGGTGACAGAGCAGG + Intronic
1053593371 9:39534527-39534549 GACCCGCCTGGTGACCGGCTGGG - Intergenic
1053851105 9:42289235-42289257 GACCCGCCTGGTGACCGGCTGGG - Intergenic
1054572935 9:66830750-66830772 GACCCGCCTGGTGACCGGCTGGG + Intergenic
1054870166 9:70042135-70042157 CTCCAGCCTGGTGACAGGGTGGG + Intergenic
1058118885 9:101116775-101116797 CTCCAGCCTGGTGACAGAGTAGG + Intronic
1058731778 9:107857358-107857380 TTCCAGCCTGGTGACAGAGTGGG - Intergenic
1059572969 9:115460128-115460150 CTCCAGCCTGGTGACAGAGCAGG + Intergenic
1060050400 9:120374549-120374571 GTCCAGCCTGGAGTCAGTGTTGG + Intergenic
1060489990 9:124076788-124076810 CTCCAGCCTGGTGACAGGGCAGG - Intergenic
1060721601 9:125983295-125983317 GTCAAGCCGGGTGACGGTGGTGG + Intergenic
1060929716 9:127481282-127481304 CTCCAGCCTGGCGACAGTGCAGG - Intronic
1061124825 9:128667990-128668012 CTCCAGCCTGGTGACAGAGCGGG - Intergenic
1186846955 X:13540395-13540417 GGCCAGCCTGGGGAACATGTGGG + Intergenic
1188961188 X:36494048-36494070 CTCCAGCCTGGTGACAGAGTGGG - Intergenic
1189199151 X:39176751-39176773 CTCCAGCCTGGTGACAGAGTGGG + Intergenic
1195057915 X:101164527-101164549 GTCCAGCCTGGTCAACATGACGG - Intergenic
1195144913 X:102003566-102003588 CTCCAGCCTGGTGACAGAGCGGG + Intergenic
1195833613 X:109088279-109088301 GTCCAGTCTTGTTACCTTGTTGG + Intergenic
1198179780 X:134195013-134195035 TTCCAGCCTGGTGACAGAGCAGG + Intergenic
1199582747 X:149376692-149376714 TGCCAGCCTGGTGACCCTCTGGG + Intergenic
1200942190 Y:8796101-8796123 TTCCAGACTGGTGCCCATGTAGG + Intergenic