ID: 1184602764

View in Genome Browser
Species Human (GRCh38)
Location 22:45553190-45553212
Sequence TCTAGGCCCCCTCCTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184602764_1184602772 10 Left 1184602764 22:45553190-45553212 CCAGGAGAAGGAGGGGGCCTAGA 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1184602772 22:45553223-45553245 TCTCTGGTGTGTGGTGGCTTAGG No data
1184602764_1184602769 1 Left 1184602764 22:45553190-45553212 CCAGGAGAAGGAGGGGGCCTAGA 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1184602769 22:45553214-45553236 GGCCTTTTTTCTCTGGTGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 216
1184602764_1184602771 4 Left 1184602764 22:45553190-45553212 CCAGGAGAAGGAGGGGGCCTAGA 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1184602771 22:45553217-45553239 CTTTTTTCTCTGGTGTGTGGTGG 0: 1
1: 0
2: 4
3: 39
4: 463
1184602764_1184602768 -6 Left 1184602764 22:45553190-45553212 CCAGGAGAAGGAGGGGGCCTAGA 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1184602768 22:45553207-45553229 CCTAGAGGGCCTTTTTTCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184602764 Original CRISPR TCTAGGCCCCCTCCTTCTCC TGG (reversed) Intronic
900270325 1:1783680-1783702 TGTAGGCCCCCTCCTCCCCTGGG - Intergenic
900357807 1:2273195-2273217 TCCAAGCCCCATGCTTCTCCCGG + Intronic
901001060 1:6149057-6149079 ACTGGATCCCCTCCTTCTCCTGG + Exonic
901150183 1:7096155-7096177 TCTAGACCCCCTCCTTCTACTGG - Intronic
902408605 1:16199929-16199951 TCTAAGCTCCCTCCTGCCCCAGG + Intronic
902421985 1:16288069-16288091 TCTCGGCTCACTCCATCTCCTGG - Intronic
902625321 1:17673101-17673123 TCCAGGTTCCCTCCTGCTCCAGG - Intronic
902960522 1:19960001-19960023 TAGAGGCGCCCTCCTTCCCCAGG + Intergenic
903340436 1:22651044-22651066 TCCAGGCCTCCTCCTAATCCAGG + Intergenic
903730859 1:25494293-25494315 TCAATGCCCCCTCCTTCACGAGG - Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904041881 1:27590101-27590123 CTTCGGGCCCCTCCTTCTCCTGG + Intronic
904052427 1:27647773-27647795 TCCTGCCCTCCTCCTTCTCCCGG - Intergenic
904379089 1:30099410-30099432 TCTTGACCACCTCCTCCTCCTGG + Intergenic
904454503 1:30639219-30639241 TCAAGGCCTCTCCCTTCTCCGGG - Intergenic
904705894 1:32390506-32390528 TCTAGGACTGCTCCTCCTCCAGG - Intronic
906044028 1:42814154-42814176 TCTCGGCAACCTCCGTCTCCTGG + Intronic
906117614 1:43366807-43366829 GCTAGGCCCCCTCCCCCTCAGGG + Intronic
906718276 1:47986723-47986745 GCTAGGCCCCCTCCCTCTTTAGG - Intronic
906943077 1:50272878-50272900 TCTATGCCCCCTCATGCTCCAGG - Intergenic
907501004 1:54880688-54880710 TCTCGGCAACCTCCATCTCCCGG - Intronic
907646903 1:56253411-56253433 TCTAGGCCTGCTTCTCCTCCTGG + Intergenic
907853470 1:58278935-58278957 TCTAATCCTTCTCCTTCTCCAGG - Intronic
910183752 1:84513208-84513230 TCTCCGCACCCTCCGTCTCCCGG + Intergenic
912506547 1:110160780-110160802 TTTGGGCCCCCTCTATCTCCCGG - Intronic
912529405 1:110309434-110309456 TCTAGGCTCTCTCCTTCCACAGG - Intergenic
913972126 1:143423494-143423516 TCAAGGCCCCCTCCCACTCCGGG - Intergenic
914066507 1:144249107-144249129 TCAAGGCCCCCTCCCACTCCGGG - Intergenic
914112646 1:144717247-144717269 TCAAGGCCCCCTCCCACTCCGGG + Intergenic
914439529 1:147691499-147691521 TCCATGCAACCTCCTTCTCCTGG - Intergenic
915167443 1:153956247-153956269 TCTGTCCACCCTCCTTCTCCAGG - Intronic
915313044 1:155013897-155013919 TCTAGATCCCCCACTTCTCCAGG - Intronic
915597492 1:156903938-156903960 TCTGTGTCCCCTCCTTCTCCTGG + Exonic
915737976 1:158096539-158096561 TCCAGGCCCCTTACCTCTCCAGG - Intronic
918130026 1:181619355-181619377 TCTAGACACCCTCCTTCCTCAGG - Intronic
919983563 1:202657656-202657678 TCTTGGCCTCCCCCTTCCCCTGG + Intronic
922233072 1:223702890-223702912 CCATGGACCCCTCCTTCTCCTGG - Intronic
923596039 1:235361442-235361464 CTTAGGCTTCCTCCTTCTCCTGG + Intergenic
924102217 1:240616530-240616552 TCTAGGTCTCCTTCTTCACCTGG - Intergenic
1064954157 10:20888607-20888629 TCTCAGCCTCCTCCTGCTCCAGG + Intronic
1065167175 10:22991684-22991706 TCTAGGCCCCTTCCTAACCCCGG - Intronic
1065337172 10:24664479-24664501 TCAATGCCACCTCCTCCTCCTGG - Intronic
1065340066 10:24696275-24696297 TCTGGGCCACTTTCTTCTCCAGG - Intronic
1066447677 10:35498560-35498582 TCTGGGCTAACTCCTTCTCCTGG - Intronic
1067583102 10:47457902-47457924 TGAAGGGCTCCTCCTTCTCCAGG + Intergenic
1070623147 10:78029368-78029390 TCTTGGCCACATCCGTCTCCCGG + Exonic
1070789822 10:79182353-79182375 TCCTGGCCCCCACCTTCTCCTGG - Intronic
1070854515 10:79595701-79595723 TCTAAGCCACCTCCCTCACCTGG + Intergenic
1070856942 10:79613671-79613693 TCTAAGCCACCTCCCTCACCTGG - Intronic
1071503911 10:86221778-86221800 TCAAGGCTCCCTGCTGCTCCTGG - Intronic
1074235224 10:111578168-111578190 TCCAGGCACCTTTCTTCTCCTGG - Intergenic
1075995594 10:126873866-126873888 TCTAGGACCCCACCCTTTCCGGG + Intergenic
1076545279 10:131240974-131240996 CCCAGGCCTCCTCCTTCACCGGG + Intronic
1076634118 10:131871798-131871820 TCACGGCCCACTCCTGCTCCCGG - Intergenic
1076763158 10:132615743-132615765 TCAAAGCCCGCCCCTTCTCCTGG - Intronic
1077050406 11:563806-563828 GCTACGCCCCATGCTTCTCCAGG - Exonic
1077307733 11:1875539-1875561 TCAAGGCCTCCTCCTGCTCCGGG + Intronic
1077374510 11:2199258-2199280 CCCAGGCCGCCTCCTGCTCCAGG - Intergenic
1077443543 11:2579642-2579664 TCCAGGACCCCACCTTCGCCTGG - Intronic
1083327054 11:61878251-61878273 TCCAGGCCACCTCCTTCTCCCGG + Intronic
1083638976 11:64135296-64135318 TCCAGGCCCCCTCCCGGTCCTGG + Intronic
1086765361 11:90690012-90690034 TATTGGCCCCCACTTTCTCCTGG + Intergenic
1088251025 11:107860895-107860917 AATAGGCCCCCTCCTACTGCAGG + Intronic
1088262895 11:107960975-107960997 TCTAGTCTCCATCCTTCTCTAGG - Intronic
1088776481 11:113089236-113089258 TCTCGGCAACCTCCGTCTCCTGG - Intronic
1088835840 11:113577478-113577500 TCTTGGACCTCTGCTTCTCCAGG - Intergenic
1088977412 11:114828088-114828110 TCTAGGCCCAAACCTTTTCCAGG - Intergenic
1089059070 11:115611420-115611442 TCAAGGCCCTCTCTTTCTCTGGG - Intergenic
1090004049 11:122984565-122984587 TCAGGGCCGCCCCCTTCTCCGGG + Intergenic
1090971860 11:131650825-131650847 TCTTGGCCTCCTTCTTCTTCAGG + Intronic
1092252194 12:6905767-6905789 CCTAGGACCCCTCCTTGTCCAGG - Intronic
1094333143 12:29318587-29318609 TCTAGACCCTTTCCTGCTCCAGG + Intronic
1095255592 12:40032079-40032101 TCCAGGCCCCACCCTTCCCCAGG + Intronic
1096078402 12:48818611-48818633 TCGCCGCCCCCGCCTTCTCCCGG + Intronic
1096291991 12:50351328-50351350 TCTCGGGCCCCTCCCACTCCAGG - Exonic
1096812783 12:54182398-54182420 TCTATGCCCTCTGCTTTTCCTGG - Exonic
1097193664 12:57232345-57232367 TCCAGGCCCTCAGCTTCTCCAGG - Intronic
1097693577 12:62756363-62756385 TCTAGGCCCCTCCCTTTTCAGGG - Intronic
1099603594 12:84772855-84772877 GCCAGGCCACCTCCTTCTGCAGG + Intergenic
1103028469 12:117593099-117593121 GCCAGGCCCCATGCTTCTCCAGG - Intronic
1103322424 12:120099870-120099892 TGTGGTCCCCCTCCTCCTCCGGG - Intronic
1104439185 12:128781282-128781304 TCTATGCCTCTTCCATCTCCTGG - Intergenic
1105025631 12:132846803-132846825 TCAAGGCCCCCTCGGCCTCCTGG - Intronic
1106697576 13:32193082-32193104 TCTAGGCACCAGGCTTCTCCTGG + Intronic
1110380150 13:74841106-74841128 TCTCTGACTCCTCCTTCTCCTGG + Intergenic
1113010717 13:105762484-105762506 TCTAATCCCCCTTCTTCTCTAGG - Intergenic
1114679909 14:24475601-24475623 TCAAGAACCACTCCTTCTCCAGG + Intergenic
1115951525 14:38727307-38727329 TCTTGTTCCGCTCCTTCTCCTGG - Intergenic
1120192796 14:81454267-81454289 TCTAGGCCCACCCCTTAGCCAGG - Intergenic
1121111033 14:91313328-91313350 GCTGGGCCACCTCCTGCTCCAGG + Exonic
1122079416 14:99256707-99256729 TCTAGGGCCCCTCTGTCCCCAGG - Intronic
1122592805 14:102867524-102867546 TCCAGCCCCCGACCTTCTCCAGG - Intronic
1122814533 14:104306056-104306078 CCTCGGCCCCTTCCTTCCCCTGG + Intergenic
1124616240 15:31244464-31244486 TCTAGCATCCCTCCTGCTCCTGG + Intergenic
1125982415 15:44014660-44014682 TCAAGGCAACCTCCATCTCCTGG - Intronic
1126445667 15:48740953-48740975 CCTAGGCCCTCTATTTCTCCTGG + Intronic
1128841960 15:70857645-70857667 CCTAGGCTCCCTCCATCTCTTGG - Intronic
1129452150 15:75657225-75657247 CCTGGGCCCCCTCCTTCCCCTGG + Exonic
1129921392 15:79322229-79322251 TCTAGGGCCCCTCATGCCCCAGG + Exonic
1130387069 15:83421379-83421401 TCACTGCACCCTCCTTCTCCTGG + Intergenic
1130691478 15:86085262-86085284 ACTAGGCACCCTCCTCATCCTGG - Intergenic
1131092214 15:89631644-89631666 TCTCGGACAGCTCCTTCTCCAGG + Exonic
1131825321 15:96317378-96317400 TCTAGTCTGCCTCCTTCTCTAGG + Intergenic
1132674666 16:1116752-1116774 TCCAGGCCACGTCCTGCTCCCGG - Intergenic
1132872787 16:2123181-2123203 TCCAGGCTGGCTCCTTCTCCCGG + Intronic
1133994742 16:10739919-10739941 CTCAGGCCCCCTCCTCCTCCTGG - Intergenic
1134551875 16:15142360-15142382 TCCAGGCTGGCTCCTTCTCCCGG + Intergenic
1138688636 16:58748359-58748381 TCTAGGCTCACTCCACCTCCCGG + Intergenic
1140314322 16:73879884-73879906 TTTTGCCCCCCTCCTTCCCCAGG - Intergenic
1140753823 16:78049609-78049631 TCTTGACCTGCTCCTTCTCCTGG + Intronic
1141652588 16:85401518-85401540 TCTGGGCCGGCTCATTCTCCTGG - Intergenic
1141690562 16:85594108-85594130 GCTGGTCCCCCTCCTCCTCCAGG - Intergenic
1141705303 16:85661471-85661493 TCCAGGCTCCCTCCCTCTCGTGG - Exonic
1142541687 17:664728-664750 TCTAGGCCTCCACCGTCTCGTGG - Intronic
1143110356 17:4549348-4549370 TCAAGGCCTCCTCCATCTCCAGG + Exonic
1144762987 17:17717785-17717807 TCCATGCAGCCTCCTTCTCCTGG - Intronic
1144863988 17:18323311-18323333 CCAAGGCCCCCTCCATATCCAGG - Intergenic
1146876170 17:36413440-36413462 TCTTGGCTCACTCCATCTCCTGG + Intronic
1147063213 17:37899433-37899455 TCTTGGCTCACTCCATCTCCTGG - Intergenic
1147228919 17:39003043-39003065 TCATTTCCCCCTCCTTCTCCGGG + Intergenic
1147443386 17:40460908-40460930 GCTGGGTCCCCTCCTTCTCTTGG + Intergenic
1147973933 17:44236999-44237021 TCTAGGCCCCTTCCCTCTTTGGG - Intergenic
1149998181 17:61415872-61415894 TCCAGGCCTCCTCTGTCTCCTGG + Intergenic
1151326552 17:73383379-73383401 TCCTGGCCCCCTCTTTTTCCTGG - Intronic
1151542759 17:74773149-74773171 TCTGGGACCCCCTCTTCTCCTGG - Intronic
1151724005 17:75874409-75874431 TCTGGGCCCTCTCCTTCGTCTGG - Exonic
1152392954 17:80013520-80013542 TCTGGGCCGCCTCCTTCGCAGGG - Exonic
1152460860 17:80441671-80441693 CCTTGGCTCCCTCCCTCTCCGGG + Intergenic
1152593810 17:81228579-81228601 TCTCAGCTCCCTCCTTCCCCAGG - Exonic
1152816667 17:82412150-82412172 TCTAGTCCCAGTCCTTCCCCAGG + Intronic
1156608172 18:38693587-38693609 TGTATGCACCCTCCTTCTCAGGG - Intergenic
1158217679 18:55116863-55116885 TCTTGGCCCCCTCCATCACTGGG - Intergenic
1158412283 18:57217995-57218017 TCTAGGCTTCCTTCTTCTGCTGG + Intergenic
1158970542 18:62662419-62662441 TCCAGGCTCCCTCCACCTCCAGG - Intergenic
1159004387 18:62999548-62999570 TCTTTGCCTCCTCCCTCTCCAGG + Intergenic
1160911322 19:1475079-1475101 TCTGGGCCACCTCCCGCTCCAGG + Exonic
1161021659 19:2014149-2014171 TCCAGGACCCCTCCTTCCCCAGG - Intronic
1161394638 19:4038581-4038603 CCTGGGCCCCCGCCTTCCCCGGG - Exonic
1161635404 19:5385566-5385588 TCTCTGCAACCTCCTTCTCCTGG - Intergenic
1162070810 19:8151211-8151233 TCTAAGTTCTCTCCTTCTCCAGG - Intronic
1162303639 19:9858274-9858296 TCTAAGCTCCTTCCTTCTGCAGG + Intronic
1162454449 19:10774842-10774864 TCTTGGCTCACTTCTTCTCCTGG + Intronic
1162608754 19:11732834-11732856 TCTAGCCTCCCTCCCTTTCCTGG + Intronic
1163088002 19:14996833-14996855 TCTACTCTCCATCCTTCTCCAGG + Intronic
1163304961 19:16472048-16472070 TCTACGGCCCCGCCCTCTCCCGG - Intronic
1163610153 19:18296533-18296555 TCACTGCCCCCTCCATCTCCCGG + Intergenic
1163671973 19:18634768-18634790 TCTAGGCACGCTCCTGCCCCAGG + Intergenic
1164774827 19:30844776-30844798 TCCAGGCCCCCTGCTTCCCGGGG - Intergenic
1165065089 19:33224222-33224244 TCTTGGCCCACACCCTCTCCAGG - Intronic
1166269816 19:41707075-41707097 CCTACACCCCCTCCTTCCCCGGG + Intronic
1167568126 19:50269806-50269828 TCTGGGGACCCTCCTTATCCTGG - Intronic
1168722933 19:58564158-58564180 TCCAGGCTTCCGCCTTCTCCAGG - Intronic
925294619 2:2768865-2768887 TCTAGGCCCCCTTTCCCTCCAGG + Intergenic
925411822 2:3643923-3643945 CGAAGGCGCCCTCCTTCTCCAGG - Exonic
925628258 2:5863385-5863407 TCTTGGCCCCTCCCTTCCCCTGG - Intergenic
927569326 2:24144631-24144653 CCTCGGCCCTCTCCATCTCCGGG - Intronic
927970971 2:27306334-27306356 CCTCGGCCACCTCCTTCACCTGG - Exonic
928010033 2:27598905-27598927 TCACCGCACCCTCCTTCTCCTGG + Intronic
928129242 2:28637733-28637755 TCTTGCTCTCCTCCTTCTCCTGG + Intronic
928157544 2:28890444-28890466 TCTGGGTCACCTCCTTCTCCTGG + Intergenic
930673985 2:54180328-54180350 TTTAGCCCCCCTCCTTTCCCTGG + Intronic
932461374 2:71883985-71884007 TTTATGCTCCCACCTTCTCCGGG - Intergenic
933348939 2:81128013-81128035 TGTAGGCTCCCTTCTGCTCCAGG + Intergenic
934176823 2:89584431-89584453 TCAAGGCCTCCTCCCACTCCGGG - Intergenic
934287130 2:91658791-91658813 TCAAGGCCTCCTCCCACTCCGGG - Intergenic
937249503 2:120514717-120514739 TCAAGCATCCCTCCTTCTCCAGG + Intergenic
937380498 2:121372278-121372300 TCTATGCCACCACCCTCTCCTGG + Intronic
938302682 2:130228244-130228266 CCTAGCCCTCCTCCTCCTCCGGG + Intergenic
938453986 2:131445978-131446000 CCTAGCCCTCCTCCTCCTCCGGG - Intergenic
938454001 2:131446017-131446039 CCTAGCCCTCCTCCTCCTCCGGG - Intergenic
940437115 2:153668661-153668683 TCCTGGCCCCCACCTACTCCTGG + Intergenic
940518011 2:154705265-154705287 TTTGGCCCCCCTCCTTCTCGTGG - Intronic
941574254 2:167211170-167211192 TCTCGGCACCCTCCACCTCCTGG + Intronic
946228210 2:218276079-218276101 TCTCTGTCCCCTTCTTCTCCAGG - Exonic
946562914 2:220933193-220933215 TCTAGGGCCACTTCTTCTGCTGG - Intergenic
947295033 2:228621580-228621602 TCTTGGCAACCTCCTCCTCCTGG + Intergenic
947610163 2:231520020-231520042 TCTAATCCCCCTCCTCCTCCTGG - Intergenic
948371764 2:237494172-237494194 TCTCTGCCCCCCCCTTCGCCGGG - Intronic
1168850246 20:971854-971876 TGTAGGCCTCCTCCTGCCCCAGG - Intronic
1169557884 20:6768736-6768758 TCTTTGCCTCCTCCTTCTCCCGG - Exonic
1169758487 20:9067823-9067845 ACTCCGCCTCCTCCTTCTCCCGG - Intergenic
1170743898 20:19081424-19081446 TCAAGACCCCCTCTTACTCCTGG + Intergenic
1171187353 20:23132351-23132373 TCCAGGCCCCGGCCCTCTCCTGG - Intergenic
1172302964 20:33862889-33862911 TCTAGGCCCCTCCCTGCGCCAGG - Intergenic
1173711948 20:45165798-45165820 TATAGGCCCCCAATTTCTCCTGG - Intergenic
1175489359 20:59369004-59369026 TCTAGACTTCCTCCTGCTCCTGG + Intergenic
1175544718 20:59770940-59770962 TCTCAGCCCCCACCTTTTCCTGG + Intronic
1175699220 20:61125097-61125119 TGTATGAACCCTCCTTCTCCTGG - Intergenic
1177161345 21:17551323-17551345 TCTCGGCTCCCTCCACCTCCCGG - Intronic
1177862274 21:26468517-26468539 TCTCCACCCCCTCCTTATCCTGG - Exonic
1179390084 21:40980447-40980469 TGTAGGCCCCCTCCCTCTGTGGG - Intergenic
1179740057 21:43412984-43413006 TCACGGCAACCTCCTTCTCCTGG - Intergenic
1180715732 22:17871055-17871077 TCTAGGCCCCCTCATTACTCTGG + Intronic
1181649838 22:24252697-24252719 GGAAGGCCGCCTCCTTCTCCCGG - Intergenic
1181707340 22:24657120-24657142 GGAAGGCCGCCTCCTTCTCCCGG + Intergenic
1183020570 22:35023021-35023043 TCTAGGGCCCCGCCGTTTCCTGG - Intergenic
1183406082 22:37631345-37631367 TCTGGGCCCCTTCCATCCCCAGG + Intronic
1183420703 22:37709794-37709816 TCTAGCCCCCGCCCTTTTCCTGG + Intronic
1183748001 22:39703536-39703558 TCTAGGCCCTCTCCCCCACCAGG + Intergenic
1184016104 22:41786784-41786806 TCTGGATCCCCTCCTTCTTCTGG - Intronic
1184385532 22:44172295-44172317 TCTGGGACCCTTCCTCCTCCCGG + Intronic
1184602764 22:45553190-45553212 TCTAGGCCCCCTCCTTCTCCTGG - Intronic
1184872853 22:47251896-47251918 CCTAGGCCTCCTGCTTATCCTGG - Intergenic
1184916819 22:47575028-47575050 TATAGGTCCCCTCCTTCCTCTGG + Intergenic
1185042170 22:48510670-48510692 TGAAGGCCTCCTCCTCCTCCAGG + Intronic
1185332850 22:50259385-50259407 GCCAGGCCGCCTCCCTCTCCAGG - Intronic
950464115 3:13143248-13143270 TCGAGGCCTGCTCCTTCTCCTGG - Intergenic
950531219 3:13553296-13553318 TCCAGGCCCACTCCTACACCTGG - Intronic
950610419 3:14123555-14123577 GGTAGGCCACCTCCTTCTCTGGG + Intronic
950629892 3:14275458-14275480 TCTAATCCCACTCATTCTCCAGG + Intergenic
950865112 3:16182601-16182623 TCTAGGGCCCCTACTGCTGCAGG - Intronic
953028312 3:39158524-39158546 TCTAGTCCCCTTCCCCCTCCTGG + Intergenic
953104901 3:39868072-39868094 TCTAGGGTCCCTCCTTATCTTGG - Intronic
954035967 3:47851390-47851412 TCAAGACCCCTACCTTCTCCAGG + Intronic
954778120 3:53038034-53038056 TCTTGGCCACCTCCGCCTCCTGG - Intronic
957338072 3:78858299-78858321 TCTCAGACCCCTCCTTCACCAGG + Intronic
958264910 3:91426776-91426798 TTTCAGCCCCCTCCTTTTCCTGG - Intergenic
960523500 3:118682476-118682498 TCTAGGCCTCCTTCTGATCCAGG + Intergenic
960601343 3:119462048-119462070 ACTAGGGCCCCTCCTTCCACCGG + Exonic
962801484 3:138894639-138894661 TCTAGACCCCTTTCCTCTCCAGG - Intergenic
962850814 3:139307113-139307135 TCTAGTCCCTCACCTCCTCCAGG + Intronic
963089680 3:141471551-141471573 TCTGGGGTCCCTTCTTCTCCAGG + Intergenic
963973992 3:151460781-151460803 TTCATGCCCCCACCTTCTCCGGG + Intergenic
966940120 3:184740939-184740961 ACCAAGCCCCCTCCTCCTCCAGG - Intergenic
968086491 3:195876262-195876284 TCTAGGCTCAGTCCTTCTCAGGG - Intronic
969072888 4:4553580-4553602 TCTCTCTCCCCTCCTTCTCCTGG + Intergenic
971225356 4:24746715-24746737 TCTAGGCACTCTACATCTCCAGG + Intergenic
971467392 4:26977906-26977928 TCTAGGTCCCCACATTCTCCTGG - Intronic
972865836 4:43231256-43231278 TCTTTGCTCCCTCCTTCTGCTGG - Intergenic
972974093 4:44612200-44612222 GCCAGGCCACCTCCTGCTCCAGG - Intergenic
974415316 4:61599405-61599427 TCTGGGCTCCCTCCACCTCCTGG + Intronic
976633702 4:87266146-87266168 TCTATTCCCCTTCCTTCACCAGG + Intergenic
977696699 4:99973370-99973392 TCTAGGCCCCCAATTTCTTCTGG - Intergenic
978690866 4:111507615-111507637 TGAAGGCCCCCTCCTACTTCTGG - Intergenic
980033876 4:127861339-127861361 TATTGGCCCCCACCCTCTCCTGG - Intergenic
980576832 4:134693902-134693924 CCAAGGCCCCCTCTTTCTTCAGG + Intergenic
983990024 4:174107329-174107351 TCAGGGCCCCCTCCAACTCCTGG - Intergenic
984674203 4:182528190-182528212 TCTCGGCAACCTCCTCCTCCTGG + Intronic
986404821 5:7415484-7415506 TCTAGGCTTCCTATTTCTCCAGG + Intronic
988269260 5:28992843-28992865 TGTAGGCCCCCACTTTCTTCTGG - Intergenic
988737847 5:34040454-34040476 TCAATCTCCCCTCCTTCTCCCGG - Intronic
990217471 5:53550117-53550139 ACTAGGCTCCATCCTTCTCCAGG - Intergenic
990386434 5:55268497-55268519 TCACTGCCCCCTCCTACTCCGGG + Intronic
994094814 5:95839142-95839164 TTTAGGGCCCCTTCTCCTCCTGG - Intergenic
995215320 5:109588649-109588671 CCTAGGGTCCCTTCTTCTCCAGG - Intergenic
997681094 5:135751227-135751249 TCAGGCCCTCCTCCTTCTCCTGG + Intergenic
998063402 5:139136937-139136959 TCCCTGCCCCCTCCTTCTGCTGG - Intronic
999249713 5:150175414-150175436 TCTCTGCACCCTCCTCCTCCAGG - Intronic
999514336 5:152285848-152285870 TCCTGCCCCCTTCCTTCTCCTGG - Intergenic
999858045 5:155616666-155616688 TCTAGGCCAACTCCATATCCTGG + Intergenic
1003533957 6:6959816-6959838 TCTAGGCTTGCTCCTTCTCTAGG - Intergenic
1004424404 6:15497704-15497726 TCTGGGCCCCTTGCTTCCCCTGG + Intronic
1005447768 6:25942235-25942257 CCTGGACCCCCTCCTTCTCTTGG + Intergenic
1006067437 6:31472027-31472049 TCTAAGACCCCTCTTCCTCCAGG - Intergenic
1006618741 6:35347681-35347703 TCACTGCCACCTCCTTCTCCTGG + Intronic
1008990473 6:57595884-57595906 TTTCAGCCCCCTCCTTTTCCTGG + Intronic
1009179047 6:60494430-60494452 TTTCAGCCCCCTCCTTTTCCTGG + Intergenic
1010058231 6:71589837-71589859 TCCAGTTCCCCTCCCTCTCCCGG + Intergenic
1013667358 6:112362363-112362385 TCTGGGGTCCCTTCTTCTCCAGG + Intergenic
1014982402 6:127960000-127960022 TCTATGCCTCCACCTTCTCATGG - Intergenic
1015694515 6:135965373-135965395 TCCAGGCTCACTCCTGCTCCAGG - Intronic
1015746557 6:136516097-136516119 TCTAGGCCCTTTCTTACTCCAGG - Intronic
1018559725 6:165089159-165089181 TCTAGGCCCTTTCCTGCTCCTGG + Intergenic
1019127931 6:169853675-169853697 TCCAGGATCCCTCCTGCTCCAGG + Intergenic
1019755817 7:2768976-2768998 TCTCGGCTCCCTCCACCTCCTGG + Intronic
1020852612 7:13376533-13376555 TCTAGTCCACCTCCTTCTGAGGG + Intergenic
1025093564 7:56081560-56081582 TCTAAGCCCCCTCCTCTCCCAGG - Intronic
1025207284 7:57001113-57001135 TCAAGTCCCCATCCTCCTCCAGG - Intergenic
1025664651 7:63575773-63575795 TCAAGTCCCCATCCTCCTCCAGG + Intergenic
1026105345 7:67416624-67416646 TCTAGTCCACCTGCTTCACCAGG - Intergenic
1026923547 7:74173864-74173886 TAAAGGCCACCTCCTTCTCCAGG - Intergenic
1027045899 7:74991338-74991360 CCTTGGCCCACTCCTTGTCCCGG - Intronic
1027115436 7:75475545-75475567 GCCAGGCCCTCCCCTTCTCCGGG + Intronic
1027120623 7:75516593-75516615 GCCAGGCCCTCCCCTTCTCCTGG + Intergenic
1027488279 7:78788935-78788957 GAGAGGCCCGCTCCTTCTCCTGG + Intronic
1029386919 7:100249233-100249255 CCTTGGCCCACTCCTTGTCCTGG + Intronic
1029663491 7:101979182-101979204 TCTAGAGCACCTCCATCTCCTGG - Intronic
1029722166 7:102375428-102375450 GCCAGGCCCTCCCCTTCTCCTGG - Intronic
1032362704 7:131271174-131271196 TGTAGGCCCCCTCCTTTTCCTGG - Intronic
1032423738 7:131803533-131803555 TCTGGCCCTCCTCCTTCTCCTGG - Intergenic
1032523854 7:132564403-132564425 GCTCCTCCCCCTCCTTCTCCAGG + Intronic
1033681964 7:143603640-143603662 GCAAGGCCACCTCCTTGTCCAGG - Intergenic
1033702926 7:143858273-143858295 GCAAGGCCACCTCCTTGTCCAGG + Intronic
1034410263 7:150937459-150937481 TCAAGTCCTCCTCATTCTCCAGG - Intergenic
1034981122 7:155477599-155477621 TCTGGTCTCCCTCCCTCTCCTGG + Intronic
1034997556 7:155587684-155587706 TCCAGGCCTCCTCCTGCCCCTGG + Intergenic
1035446302 7:158945285-158945307 TGATGGCCCCCACCTTCTCCAGG + Intronic
1035474949 7:159136706-159136728 TCGGGGCCTCCTCCTTTTCCTGG - Intronic
1038539897 8:28383740-28383762 TCTGAGCCCCTTCCCTCTCCCGG + Intronic
1038662276 8:29507501-29507523 CCTATGGCCCCTCCTTCTCTAGG - Intergenic
1038729373 8:30113501-30113523 AGTAAGCCCCCTCCTGCTCCTGG - Intronic
1038876929 8:31560605-31560627 AATAGGCCCCCACCCTCTCCTGG - Intergenic
1039256276 8:35722451-35722473 ACTAGACCCCAGCCTTCTCCTGG + Intronic
1039468892 8:37801727-37801749 GCAAGGCACCCTTCTTCTCCTGG - Intronic
1040671149 8:49691842-49691864 TGTAGGCTCCCTCCATCCCCAGG - Intergenic
1042038489 8:64565115-64565137 TATTGGCCCCCACTTTCTCCTGG + Intergenic
1044727171 8:95203295-95203317 TCTGGGCCTCCTCCATCTGCTGG + Intergenic
1045418377 8:101989814-101989836 CCTAGGCCCTCTCGTTCTCCTGG + Intronic
1046466579 8:114612036-114612058 ACTAGGCCCCCTCCACCTCCAGG - Intergenic
1046666423 8:117008726-117008748 TCAAGGCCCCCTTCTGCTTCAGG + Intronic
1048899219 8:139021969-139021991 TCCAGCCCCTCTCCCTCTCCTGG - Intergenic
1048945258 8:139441096-139441118 TCACTGCCCCCTCCATCTCCTGG - Intergenic
1049367294 8:142246521-142246543 TCCAGGCTGCCTCCTCCTCCAGG - Intronic
1052246905 9:26347177-26347199 TCTAGGACCCCACCTTCCACCGG + Intergenic
1055144976 9:72922475-72922497 CCTATGCCTACTCCTTCTCCAGG - Intronic
1055708877 9:79037332-79037354 TCTAGGGTCTCTTCTTCTCCAGG + Intergenic
1057119469 9:92558674-92558696 TCTAGGACCCCGCCTACTGCTGG - Intronic
1059324952 9:113498383-113498405 TCTCGGCCCCCTGCTTCCCCTGG + Intronic
1059656243 9:116360227-116360249 TCTAGGCCCCATGATTCTCCTGG - Intronic
1060171159 9:121462248-121462270 TCACGGCAACCTCCTTCTCCTGG - Intergenic
1060401061 9:123349874-123349896 TCTGGGCCACCTCCTCCTTCAGG - Intergenic
1060504987 9:124191061-124191083 TCTCGGCCCCATCCCACTCCTGG + Intergenic
1060864906 9:126987970-126987992 TCTTGGCCACCCCGTTCTCCTGG - Intronic
1060944435 9:127561618-127561640 TCTGGGCTCCCTGCTTCTTCAGG + Intronic
1061670205 9:132184320-132184342 CCTCGGCCCCTTCCCTCTCCAGG - Intronic
1062173159 9:135146536-135146558 TCTCTGCCCCCTCCAGCTCCTGG + Intergenic
1062270501 9:135706014-135706036 TCCAGGCCCTCTGCTCCTCCCGG - Intronic
1062291052 9:135794542-135794564 TCTAGGCCCCCTGCTCCGCCTGG + Intergenic
1062504695 9:136866840-136866862 TCTCGGCTCACTCCGTCTCCCGG + Intronic
1062573902 9:137197804-137197826 TCCAGGGCCCCTCCCACTCCTGG - Intronic
1185621986 X:1455613-1455635 TTTAGGGCCCGTCCTTCTCCAGG + Intergenic
1185865319 X:3619159-3619181 TTTAGGGCCCACCCTTCTCCAGG - Intronic
1185918458 X:4062741-4062763 TTTAGGGCCCTTCCTCCTCCAGG - Intergenic
1186774758 X:12854099-12854121 TGGAGGCCTGCTCCTTCTCCTGG + Intergenic
1187447687 X:19373182-19373204 TTCCGGCCCCCTCCTCCTCCTGG - Intronic
1187960184 X:24560538-24560560 TCTTGGCACTTTCCTTCTCCAGG - Intronic
1188245100 X:27829757-27829779 TCTAGGATTCCTCCTTCTGCTGG - Intergenic
1192194508 X:69019274-69019296 TGCAGGCCCCTTCCTTCTACTGG - Intergenic
1192405772 X:70884924-70884946 TCTAGTGCCCCAACTTCTCCAGG + Intronic
1193272837 X:79548961-79548983 TTTAGGCCTCCTTCTACTCCTGG + Intergenic
1194660034 X:96620812-96620834 TGTCTGCCTCCTCCTTCTCCAGG - Intergenic
1195149018 X:102046278-102046300 TATAGGCCCCCTACCTCTTCTGG - Intergenic
1195387075 X:104323553-104323575 TCTCAGCTCCCTCATTCTCCAGG - Intergenic
1199215009 X:145253062-145253084 TCTAGGCCCCGTCTGTCTTCAGG + Intronic
1200798374 Y:7362336-7362358 TTTAGGGCCCACCCTTCTCCAGG + Intergenic