ID: 1184602775

View in Genome Browser
Species Human (GRCh38)
Location 22:45553253-45553275
Sequence CCCTAACACCTCAAGCTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184602775_1184602777 -5 Left 1184602775 22:45553253-45553275 CCATAGAGCTTGAGGTGTTAGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1184602777 22:45553271-45553293 TAGGGTCAAATGTGTTGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1184602775_1184602778 3 Left 1184602775 22:45553253-45553275 CCATAGAGCTTGAGGTGTTAGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1184602778 22:45553279-45553301 AATGTGTTGAACTGGCAAGTTGG 0: 1
1: 0
2: 0
3: 16
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184602775 Original CRISPR CCCTAACACCTCAAGCTCTA TGG (reversed) Intronic
901207778 1:7507299-7507321 CCCTACCAGCTCCAGCTCTCCGG + Intronic
908029881 1:59987829-59987851 CCCAAAAACCTCAGGCTTTAAGG - Intronic
921716289 1:218420139-218420161 CCACAAGACCTCAAGCTCTCTGG - Intronic
922377377 1:224981974-224981996 CCCTATGACCTAATGCTCTAAGG - Intronic
922683071 1:227616992-227617014 CCATGACACCTCAAGCACCATGG - Intronic
923916391 1:238510765-238510787 CCCAAATACCTCAAGCACCATGG - Intergenic
1065270085 10:24020643-24020665 CTCAAACACCTCAAGCGATAAGG - Intronic
1067350367 10:45470307-45470329 CCCTCAGTCCTCAAGCTTTAGGG - Intronic
1068119832 10:52774305-52774327 CCCCAACACCCCAAGCTACATGG - Intergenic
1076929259 10:133518763-133518785 CCCTATGACCTAATGCTCTAAGG + Intergenic
1078161291 11:8841877-8841899 CCCAAACACCTCCAGATCAAGGG + Intronic
1081152377 11:39648184-39648206 CCTTAGCACCTCAGGCTCTGGGG - Intergenic
1082961741 11:58924397-58924419 CCCTATGACCTAATGCTCTAAGG + Intronic
1082962199 11:58928966-58928988 CCCTATGACCTAATGCTCTAAGG + Intronic
1083125396 11:60560301-60560323 CCCTATGACCTAATGCTCTAAGG + Intergenic
1083207278 11:61160387-61160409 CACCACCACCTCCAGCTCTAAGG + Intronic
1083443927 11:62694658-62694680 CTCTGGCAGCTCAAGCTCTAAGG + Exonic
1086349506 11:85931325-85931347 CCCTATGACCTAATGCTCTAAGG + Intergenic
1088367514 11:109054838-109054860 GCCTCACTCCTCAACCTCTAGGG + Intergenic
1090753996 11:129772695-129772717 CACTGACACCTCAAGCACCATGG + Intergenic
1091669533 12:2442915-2442937 CCCAAACACCTCCAACCCTAGGG + Intronic
1091901259 12:4145818-4145840 CCCTATCCCCTGTAGCTCTAGGG - Intergenic
1093407770 12:18825957-18825979 CACTATCATCTCAAGCTATAAGG - Intergenic
1093801852 12:23383061-23383083 CACTCACACCCGAAGCTCTAGGG - Intergenic
1097807318 12:63980126-63980148 CACTATTGCCTCAAGCTCTAGGG + Intronic
1098329022 12:69333040-69333062 CCCTATGACCTAATGCTCTAAGG + Intergenic
1098918991 12:76285675-76285697 CCCCAACACCTCAAGCTGCCTGG + Intergenic
1102515236 12:113441818-113441840 CCCTAACACCTCCACCTCCAGGG + Intergenic
1106036568 13:26050303-26050325 CCCTAAGACATGAAGCCCTATGG + Intronic
1109721590 13:66282859-66282881 GCCAAACACCTCAAGCACTGGGG + Intergenic
1111685063 13:91491643-91491665 CCCTTGCTCCTGAAGCTCTAGGG + Intronic
1116929395 14:50674701-50674723 GCCTAACACCTGAAATTCTATGG - Intergenic
1117726543 14:58680260-58680282 TGCTAACACCTCAGCCTCTATGG + Intergenic
1118972573 14:70649604-70649626 CCCTACCACCTCCATCTTTAGGG + Intronic
1123141803 14:106087226-106087248 CCCTACAACCTAATGCTCTAAGG - Intergenic
1125907603 15:43407878-43407900 GCCTAACACCTACAGGTCTAAGG + Intronic
1130537731 15:84798978-84799000 CCCGAAGACCTCAAGATCTGTGG - Intronic
1135700763 16:24630673-24630695 CCCTAAGGCCTCATGCTGTAGGG + Intergenic
1138114574 16:54350297-54350319 TGCTAACACCTCTACCTCTAAGG - Intergenic
1138318918 16:56094312-56094334 CACTGACACCTCAAGCACCATGG + Intergenic
1143773385 17:9182383-9182405 GCCTCACATCTCAAGCGCTAAGG - Intronic
1148355279 17:46971758-46971780 CTCTCACGCCTCAAGCTCTGTGG + Intronic
1148585023 17:48771554-48771576 CACTATAACCTCAAGCTCTCAGG - Intronic
1151592257 17:75053189-75053211 CACACACACCTCCAGCTCTAAGG - Intronic
1151757958 17:76085502-76085524 CCCAAACTCCACAAGCTCTATGG + Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1156484708 18:37457388-37457410 CCCTTACACCCCAAGATCCAGGG + Intronic
1158729199 18:60003879-60003901 GCCTAACACCCTAAGCTCTCTGG - Intergenic
1164128921 19:22344246-22344268 CCCAAACATGTCCAGCTCTAGGG - Intergenic
1164382468 19:27746676-27746698 CAGTAACACCTCTAGCGCTATGG + Intergenic
1167316084 19:48763602-48763624 TCCTCACACCTCAGGCTCCAGGG - Intergenic
1167905681 19:52658692-52658714 CCCTATGACCTAATGCTCTAAGG - Intronic
934589826 2:95537185-95537207 CCCTTAAACCTCAAGCTTTTTGG - Intergenic
935186953 2:100743294-100743316 CCCTAACACCTTAAGGTCACGGG + Intergenic
937894887 2:126971284-126971306 CCCGGAGACATCAAGCTCTAGGG + Intergenic
938549983 2:132371005-132371027 CCCTCAAACCTCAGGCTCTATGG - Intergenic
938624933 2:133097844-133097866 CCCAAACAACACAAGCTCTGAGG - Intronic
940256672 2:151738391-151738413 CACTAACACCTCAAACTTTCTGG + Intergenic
940467215 2:154046247-154046269 CCCTGAAACCTCAAACTCTTTGG - Intronic
940472109 2:154113261-154113283 CACTGACACCTCAAGCACCATGG + Intronic
941236212 2:162977549-162977571 CCCTGACACCCCAAACTCAATGG - Intergenic
942865948 2:180675190-180675212 TTCTAGCACCTTAAGCTCTAGGG - Intergenic
945368374 2:208984995-208985017 CCCTCAAATCTCAAGATCTAAGG - Intergenic
947529668 2:230900877-230900899 CCCCAACTCCTCCAGCTTTATGG + Intergenic
948881661 2:240860906-240860928 CCCTAACTTCTCTATCTCTATGG + Intergenic
1170414577 20:16126094-16126116 CACTAAAACCTCAAACTCTTGGG - Intergenic
1174488919 20:50878564-50878586 CCCTGAAACCTCAAGCTCCTGGG + Intronic
1178296423 21:31414071-31414093 CCCTACCGCCTCAGGCTCTCAGG + Intronic
1180185623 21:46137757-46137779 CCCTAAGACCTCATGGTCTTCGG - Intronic
1180706767 22:17815120-17815142 CTCTAAGGCCTCACGCTCTAGGG - Intronic
1181367227 22:22387358-22387380 CCCTATGACCTAATGCTCTAAGG + Intergenic
1182476055 22:30576903-30576925 CCCTGACCCCTCATGCTCTCTGG - Exonic
1184602775 22:45553253-45553275 CCCTAACACCTCAAGCTCTATGG - Intronic
951023470 3:17805664-17805686 CCGTGACACTTCTAGCTCTAAGG + Intronic
970546710 4:17137582-17137604 CCCTAAGGCCCCAAGCTCCAAGG + Intergenic
975584909 4:75940250-75940272 CCCTGAGACCTCACGCCCTAAGG - Intronic
981141964 4:141279078-141279100 CCCTACGACCTAATGCTCTAAGG + Intergenic
982385218 4:154794111-154794133 CCCTTCCACCTCAACCTCTCTGG + Intronic
985296044 4:188438446-188438468 CCCTAAGACCTAATGCTCTAAGG - Intergenic
986305142 5:6508981-6509003 CCCCAGCACCTCAGGCTCAACGG + Intergenic
993717106 5:91286135-91286157 CACTAACACCTCAAGCCAAATGG + Intergenic
1000813496 5:165891338-165891360 CCCCACCTCCTCAACCTCTAGGG + Intergenic
1004866498 6:19858043-19858065 CCCAAACACCTCAAATTCTTAGG + Intergenic
1006983560 6:38163538-38163560 CCCCAACACCTCCACCTCTAGGG - Intergenic
1007422532 6:41728377-41728399 CTCTGACACCCCCAGCTCTACGG + Intronic
1008057378 6:46959493-46959515 CCCTAACACCTTTAGTTTTAAGG - Intergenic
1008656950 6:53624786-53624808 GCTTAACAGCTCAACCTCTATGG + Intergenic
1008703928 6:54134690-54134712 CCCTAACAGTTACAGCTCTATGG + Intronic
1009364796 6:62849648-62849670 CCCTATGACCTAATGCTCTAGGG + Intergenic
1013893438 6:115054477-115054499 CCCTATGACCTAATGCTCTAAGG + Intergenic
1028146904 7:87329061-87329083 CCCTAACATTTCAAACCCTACGG - Intergenic
1039070910 8:33648565-33648587 CCCTCACACCTCATACTCCATGG - Intergenic
1040442273 8:47456158-47456180 CCATTACACCTCAGGCTATATGG + Intronic
1041359464 8:57036749-57036771 CCCTATGACCTAATGCTCTAAGG + Intergenic
1043846478 8:85169717-85169739 CCCTAACATCTCAATCTTGAAGG - Intergenic
1047255143 8:123208439-123208461 CCCTGACAACTCAAGCTCCTAGG - Exonic
1051232603 9:14968036-14968058 CCCTATGACCTAATGCTCTAAGG - Intergenic
1058503186 9:105643361-105643383 CACTATCACCTCGAGCTCCATGG + Intergenic
1188939130 X:36215768-36215790 CCCTATGACCTAATGCTCTAAGG - Intergenic
1191191460 X:57672874-57672896 CCCTAACACCTCAAAATATCTGG + Intergenic
1193656366 X:84203035-84203057 CACTAACAACTCAGGCTCAATGG - Intergenic
1194218703 X:91165829-91165851 CCCTATGACCTAATGCTCTAAGG + Intergenic
1196968538 X:121084362-121084384 CCCTATGACCTAATGCTCTAGGG - Intergenic
1200555212 Y:4629581-4629603 CCCTATGACCTAATGCTCTAAGG + Intergenic
1200745464 Y:6900162-6900184 CCCTATGACCTAATGCTCTAAGG - Intergenic
1202305650 Y:23467556-23467578 CCCTATCACCCCCAACTCTAAGG - Intergenic
1202565159 Y:26203033-26203055 CCCTATCACCCCCAACTCTAAGG + Intergenic