ID: 1184610342

View in Genome Browser
Species Human (GRCh38)
Location 22:45599273-45599295
Sequence CAGGGCAGTCAAAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184610342 Original CRISPR CAGGGCAGTCAAAAGGAGGA TGG (reversed) Intronic
900329923 1:2128946-2128968 CAGCGCTGTGAAAAGGAGAAGGG - Intronic
900648364 1:3719073-3719095 CAGGGGCGGCAAAAGGAGAAGGG - Intronic
901460025 1:9385851-9385873 CAGGGCAGTAGACAGGCGGAGGG + Intergenic
903076952 1:20777843-20777865 CAGAGAATTCCAAAGGAGGATGG - Intronic
903823545 1:26123582-26123604 CAGGGCAGGCAAAGTGAGGGTGG - Exonic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904417674 1:30373119-30373141 CTGGCCAGTCACCAGGAGGATGG - Intergenic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
906414219 1:45607431-45607453 CAGGACAGTGAAATGGAGAAGGG + Exonic
906711103 1:47930521-47930543 CAGGGCAGTAGCAGGGAGGAGGG - Intronic
907520154 1:55018561-55018583 CAGGGCTATGACAAGGAGGAAGG + Intergenic
907687190 1:56623562-56623584 TAGGGCAGTGAAAAGGATAAAGG + Intronic
908606440 1:65802248-65802270 CAGTGGAGTCAAAAGCAGGAAGG - Intronic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
909417674 1:75425886-75425908 AAGGGCACTGAAAGGGAGGAAGG - Intronic
909869202 1:80718107-80718129 CATGGAAGTCAAAAGTAGAATGG - Intergenic
910268239 1:85364161-85364183 CAGTGAAGTGAAAATGAGGATGG - Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910843702 1:91585689-91585711 AAGGGCAGAGAAAAAGAGGAAGG + Intergenic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
912503478 1:110137940-110137962 AAGGGCAGTCTAGAGGAGCAGGG + Intergenic
912623117 1:111185731-111185753 CAGAGCAGGACAAAGGAGGAAGG + Intergenic
912825754 1:112901639-112901661 CAGGGGACTCTAAAGGAGTAAGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915830487 1:159124967-159124989 CAGGGGAGTCAAAAGCAGAGAGG - Intronic
916249958 1:162728369-162728391 CAGGCCAGGTAAAAAGAGGAAGG + Intronic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
916961568 1:169894267-169894289 CAGGGCGGAGAAAAGGAGTACGG + Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
918414409 1:184291833-184291855 CAAGGCATTCCAAAGGAAGAGGG - Intergenic
919758645 1:201082497-201082519 CTAGGCAGTCAAAGGGAGGAGGG - Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920396475 1:205649646-205649668 CAGGGCACACAAAAGGAGCCTGG - Intergenic
921214397 1:212924820-212924842 GAGGGAAGTCACAAGGATGAAGG - Intergenic
921279473 1:213551332-213551354 CAGCCCAGACAAAAGGGGGAAGG + Intergenic
921356552 1:214289800-214289822 CAGGCCACTCATCAGGAGGAAGG - Intronic
923307227 1:232699267-232699289 ATGGGCAGGGAAAAGGAGGAAGG + Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924413050 1:243826551-243826573 CAAGGCAGTCAAATGGGAGATGG - Intronic
924638304 1:245809450-245809472 CAGTGAGTTCAAAAGGAGGAAGG + Intronic
1063633400 10:7756533-7756555 CTGGGCAGGCAAAAGGAGCTTGG - Intronic
1064310976 10:14211568-14211590 CATGGCAGGAGAAAGGAGGATGG - Intronic
1064328143 10:14369954-14369976 CAGAGCAATCCAAAGGAGAATGG - Intronic
1064681563 10:17815525-17815547 TAGGGCGGTCAGCAGGAGGAAGG + Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064962157 10:20977162-20977184 AAGGGCAGTGAAATGGAGGTCGG - Intronic
1065742027 10:28805672-28805694 CAGGGCAAGAAAAAGGAGTAGGG - Intergenic
1066698385 10:38099536-38099558 CACAACAGTTAAAAGGAGGAAGG - Intronic
1066956768 10:42180220-42180242 CAGGACAGCCCAAAGGAGGGGGG - Intergenic
1066994129 10:42547610-42547632 CACAACAGTTAAAAGGAGGAAGG + Intergenic
1068135698 10:52949874-52949896 CAGGCCAGTAAAAATCAGGAAGG - Intergenic
1069603676 10:69726230-69726252 CACAGCAGCCAAAAGGTGGAAGG - Intergenic
1069825668 10:71253685-71253707 CAGGGCTGCCAAGGGGAGGAGGG + Intronic
1070353163 10:75613022-75613044 CAGGAACGTCAAAAGAAGGAAGG - Intronic
1070853357 10:79585249-79585271 CAGGCCAGGCACAAGGAGAAGGG + Intergenic
1072444573 10:95487519-95487541 AAAGGCAGTCAGACGGAGGAAGG + Intronic
1072525669 10:96269510-96269532 CATGGCAGTGAGAAGGAAGAGGG - Intronic
1072546369 10:96442505-96442527 CAGGGCAGTCCTGAAGAGGAAGG - Intronic
1073465798 10:103693915-103693937 CAGGGCAGGTAAACGGAGGCTGG - Intronic
1073650505 10:105353370-105353392 CAGGTCAGTGCAAAGGAGCAAGG - Intergenic
1073959076 10:108905082-108905104 GAGGCCAGAGAAAAGGAGGAGGG + Intergenic
1074378006 10:112954018-112954040 CAGAGCAGTGGAAATGAGGATGG + Intronic
1074792145 10:116900490-116900512 AAAGGCAGACAAAAGGAGGAAGG + Intronic
1075442779 10:122493164-122493186 CAGGGCAGGCAAGAGGGGGCTGG - Intronic
1075570045 10:123534958-123534980 TAGGGAAGTCACAAGGGGGAGGG + Intergenic
1075787581 10:125060645-125060667 CAGGGCAGTCATGCGGAAGAGGG + Intronic
1076150675 10:128159772-128159794 CGGGGCAGCCCAAAGGAGGTAGG + Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1080428868 11:32180201-32180223 GAGTGCAGTAAAGAGGAGGAGGG - Intergenic
1080695937 11:34603043-34603065 CAGGGAAGACAAGAGGAGAAGGG - Intergenic
1081730758 11:45370193-45370215 AGGGGCAGTCAGGAGGAGGAGGG + Intergenic
1081971847 11:47204825-47204847 CAGGGCAGTGGAAAGGAGGGTGG - Intergenic
1082060733 11:47857923-47857945 CTTGGCAGGCAAAATGAGGAAGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083297715 11:61724208-61724230 CATGGCAGACAAAATGAGGGAGG + Intronic
1083320493 11:61842961-61842983 CAGTGCAGCCAACAGGAAGAAGG - Intronic
1084272898 11:68038585-68038607 CAGGGTGGTCAAGAGCAGGAAGG + Intergenic
1087938560 11:104064623-104064645 AAGAGAAGTGAAAAGGAGGAAGG + Intronic
1088182696 11:107129941-107129963 CAGCACAGTCCAGAGGAGGAAGG + Intergenic
1088318382 11:108530455-108530477 CAGGGAAGGCAATAGGAAGATGG + Intronic
1088466731 11:110147701-110147723 AAGGGGAGGCAAAAGGAGTAAGG - Intronic
1089253026 11:117178942-117178964 CAGGGCCGTGAGAAGGAGGGCGG - Exonic
1089345634 11:117789709-117789731 CAGGGCTGTCAAGTGGAAGAGGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1090132680 11:124161062-124161084 CAGGGCTGTAAAGAGGATGATGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091372504 11:135072731-135072753 CAGGGCAGCCAAATGGAGACAGG + Intergenic
1091541352 12:1465656-1465678 CAGGGGAGTCAAGTGGAGAATGG - Intronic
1091718961 12:2798572-2798594 AAGGGCAGTCACAAGGAGTTGGG - Intronic
1092198747 12:6566598-6566620 CAGGGCAGCCAAGAGGAGATTGG - Exonic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093628717 12:21383035-21383057 CAGGTCAGGCAAAAGAAGAATGG + Intronic
1094327980 12:29260611-29260633 CAGGGGAGTGAAGAGTAGGAAGG + Intronic
1094641639 12:32281746-32281768 CTGGGCAGCCAAAAGAAGGAGGG - Intronic
1094694932 12:32809071-32809093 CTGGGCAGTCCAGATGAGGAAGG - Intronic
1095875093 12:47071409-47071431 CAAGCCAGACAAAAGGAGGCAGG + Intergenic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1097241602 12:57579226-57579248 AAGGGCAGTCCAAAGGAGTCAGG + Intronic
1097956921 12:65495699-65495721 CAGGGCAGTCAAGAGGAAGTGGG - Intergenic
1099151363 12:79118038-79118060 CAGGGAGGTCAAAAGGACCAAGG - Intronic
1099849507 12:88074642-88074664 TAGGGCAGGTGAAAGGAGGATGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102471716 12:113163202-113163224 CAGGGGAGCCAAGAGGCGGAGGG - Exonic
1102990704 12:117313809-117313831 TAGGGGAGCCAAAAGGAGAAAGG - Intronic
1104788495 12:131467062-131467084 CACCTCAGTCAACAGGAGGATGG + Intergenic
1104814476 12:131637830-131637852 TGGGGCAGTCAGAGGGAGGAGGG + Intergenic
1105241439 13:18612200-18612222 CAGGGATTTCAAACGGAGGAAGG + Intergenic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1107659454 13:42624173-42624195 AAGGGAAGTGAAAAGGAGAATGG - Intergenic
1107667146 13:42702901-42702923 CAGGGCAGTGAAAAGGCAGTGGG - Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1109167192 13:59050898-59050920 GAGGGAAGTCAAAAAGAAGAGGG + Intergenic
1112563077 13:100530853-100530875 CAGGGCAGTCACAAGGAGCTTGG + Exonic
1113393786 13:109923916-109923938 CTGGGTAGTGAAAACGAGGAAGG - Intergenic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117966261 14:61209811-61209833 CAGGGAGTTCAAAAGGAGGGAGG - Intronic
1118460341 14:65981339-65981361 CAGGGCAGACAAAAGGGTGTTGG + Intronic
1118526177 14:66646519-66646541 CAGAACAGCCAAAAGGTGGAAGG + Intronic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1119477878 14:74941618-74941640 CTCAGCTGTCAAAAGGAGGAAGG + Intergenic
1119986436 14:79143383-79143405 AAAGTCAGTGAAAAGGAGGAGGG + Intronic
1120521987 14:85534456-85534478 CAGGGATGTCAAAAGGGGAAAGG - Intronic
1121870046 14:97399006-97399028 AAGGTCAGTCAAAAGGGAGATGG + Intergenic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1123489920 15:20772950-20772972 CAGGGATTTCAAACGGAGGAAGG - Intergenic
1123546419 15:21342037-21342059 CAGGGATTTCAAACGGAGGAAGG - Intergenic
1123956017 15:25335518-25335540 AAGGGCAGTATAAAGAAGGAAGG + Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1126790836 15:52219771-52219793 CATCGCAGTCAAGAGGAGGAAGG - Exonic
1127476575 15:59339490-59339512 GAAGGCAGTCAATAGGAGGCTGG - Intronic
1127918052 15:63471679-63471701 CCAGGCAGACAATAGGAGGAAGG + Intergenic
1129299997 15:74619991-74620013 CATGGCTGCCAAAAGGGGGATGG - Exonic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130850666 15:87790684-87790706 AAGGGCTGTCACAAGAAGGAAGG + Intergenic
1130879810 15:88045307-88045329 CAGGACAATCAACAGCAGGATGG - Intronic
1131254454 15:90852830-90852852 CAGGGCAGGCAAAAGGATGTGGG + Intergenic
1131858403 15:96624866-96624888 CAGGGCATGCAAAAGGAACATGG + Intergenic
1132294174 15:100723209-100723231 CAGGAAAGTAAAAAGGAGAAAGG - Intergenic
1202954746 15_KI270727v1_random:69252-69274 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1132709487 16:1260060-1260082 CAGGGCAGAGAAGAGGTGGAAGG - Intergenic
1133295708 16:4751262-4751284 CAGGCCAGACAAAAGCTGGAAGG + Exonic
1134059940 16:11193189-11193211 CAGGGAAGACAAAATGATGATGG - Intergenic
1134741966 16:16555612-16555634 CAGGGCAGTCCCAATGAGTAAGG - Intergenic
1134925592 16:18156844-18156866 CAGGGCAGTCCCAATGAGTAAGG + Intergenic
1135848367 16:25939798-25939820 TAGGGCAGCCAGAATGAGGAAGG + Intronic
1137005389 16:35270822-35270844 CAGGCCAGTAAAAATCAGGAAGG - Intergenic
1137870429 16:51945023-51945045 CAGGGCAGTCGCAAGTAGTAAGG - Intergenic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1139703791 16:68726370-68726392 CGGGGCAGCCAAGAGAAGGAAGG - Intergenic
1140637379 16:76931025-76931047 GAGGGCAGTAAAAAGTAGTAGGG - Intergenic
1141308642 16:82891322-82891344 CAGTGCAGATAAAAAGAGGATGG - Intronic
1141426693 16:83949009-83949031 AAGGGCAGGCAAAAGGGCGATGG - Intronic
1142266504 16:89066406-89066428 CAGTGGAGTCAAGAGGGGGACGG + Intergenic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1145935136 17:28710955-28710977 CAGAGCAGCCGAAAGGAGTAGGG + Intronic
1146122909 17:30210703-30210725 CAGGACAGTGAACAGGAGGGAGG + Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1151161690 17:72171265-72171287 CCTGGCAGTCAAAGGGAGGAGGG - Intergenic
1152093228 17:78258274-78258296 CAGGACACACCAAAGGAGGAGGG - Intergenic
1152228232 17:79102471-79102493 CAGGGCAGCCAAAGGGTGGCTGG - Intronic
1152373606 17:79906032-79906054 AAGAGCTGTCAAAACGAGGAAGG - Intergenic
1154447520 18:14447706-14447728 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1155247165 18:23921763-23921785 CTGGGCAGTGGAAAGAAGGAGGG + Intronic
1155402688 18:25456536-25456558 CAGGCAAATCAAAAGGCGGAGGG + Intergenic
1155727912 18:29112611-29112633 CAGGTCAGTTGAAAAGAGGATGG + Intergenic
1156244502 18:35284612-35284634 CAGAGCAGTCACCAGGAGCAGGG + Intronic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1157777366 18:50406213-50406235 CAGGCCAGTAAAAATCAGGAAGG + Intergenic
1159283043 18:66311460-66311482 GATGGCAGGCAAAAGGAGAATGG + Intergenic
1159851252 18:73529340-73529362 CAGGGCTGTGCAATGGAGGATGG + Intergenic
1160347435 18:78145292-78145314 CAGGGCTGTCCAAAGGAAGGGGG + Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1164063021 19:21691675-21691697 CAGGCCAGTAAAAATCAGGAAGG - Intergenic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1165035812 19:33032843-33032865 CCTGGCAGGCAATAGGAGGAAGG - Intronic
1165156452 19:33791825-33791847 CAGGGCAGGCCCAAGGAGAAGGG + Intergenic
1165871547 19:38976308-38976330 CAGGGGAGTCCTAAGGTGGAAGG - Intergenic
1166552482 19:43675597-43675619 CAGGTGAGTCACGAGGAGGAAGG - Intergenic
1166762816 19:45235374-45235396 CAGGGCGGAAAAATGGAGGAGGG + Intronic
925337179 2:3107144-3107166 CAGGGCACCCTAAAGGTGGATGG - Intergenic
925337225 2:3107343-3107365 CAGGGCACCCTAAAGGTGGATGG - Intergenic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925596522 2:5560957-5560979 ATGGTCAGTCACAAGGAGGAAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926164760 2:10514423-10514445 CAAGGCAGTCAAAAGGCTGGAGG + Intergenic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
926991138 2:18681645-18681667 CAGGGCAGAGCAAAGGAGGTAGG + Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
928372085 2:30747535-30747557 CAGGACAGTGAAAAGGATGAGGG - Intronic
928694124 2:33831809-33831831 AAGGGAAGACAAAAGGAGCAGGG + Intergenic
928782680 2:34844079-34844101 CTAGGAAGTCAAAAAGAGGAGGG + Intergenic
929570913 2:43022318-43022340 CAGGGCAGTCAGAATGAAGGCGG + Intergenic
930198453 2:48530651-48530673 AACAGCAGTCAGAAGGAGGAGGG - Intronic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
932297219 2:70636318-70636340 AAGGGCAGTCACCAGGAGTATGG - Intronic
932576854 2:72967278-72967300 CAGGGCAGTGAACAAAAGGATGG + Intronic
934028774 2:88022720-88022742 CAGCGCAGTCACACGGTGGAAGG - Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
935093834 2:99924598-99924620 GAGGGCTGTCATGAGGAGGAGGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
936523386 2:113226524-113226546 CAGAACAGTCCAAATGAGGATGG + Intronic
937025480 2:118693636-118693658 CGAGGCAGCCAAGAGGAGGAGGG - Intergenic
937312165 2:120909151-120909173 CACGTCAGCCAAAAGGCGGAGGG - Intronic
938308145 2:130268333-130268355 CAGGGAAGTGAAAAGGAGGAGGG - Intergenic
938447186 2:131388503-131388525 CAGGGAAGTGAAAAGGAGGAGGG + Intergenic
939111372 2:138011967-138011989 CAGGGCAGTAATAAAGAGCATGG - Intronic
939523830 2:143266458-143266480 CAGGGCAGACTAAAGGTGGTTGG + Intronic
939660181 2:144879629-144879651 CATGGCAGTCAGAAGTAGCATGG - Intergenic
940667852 2:156630976-156630998 CAGGGCAGTCAGGAGGCAGACGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941767718 2:169316255-169316277 GTGGGCAGTGAAAAAGAGGAAGG + Intronic
942135486 2:172920874-172920896 CAGGTCTGTCAGAAAGAGGAAGG - Intronic
942403030 2:175623297-175623319 GATGGCAGTGATAAGGAGGAAGG - Intergenic
942498721 2:176565863-176565885 CCAGGCAGCCAAAAGGAGGGCGG - Intergenic
944677221 2:202043586-202043608 CAGGGCAGGCTCAAGGAGGGTGG + Intergenic
945923064 2:215776139-215776161 CAGGGCAGATTAAAGGAGGAAGG + Intergenic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946367693 2:219259830-219259852 CAGTGCTGTGAGAAGGAGGATGG - Intronic
946691203 2:222309628-222309650 CAGGACATTCAAAAGCAGGGTGG + Intergenic
947468578 2:230378390-230378412 CTAGGCAGTCAGAAGGAGAAAGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948525361 2:238567759-238567781 AGGGGAAGTCAAAAGGGGGATGG - Intergenic
1169697284 20:8404510-8404532 CAGGGGAGAAAAAAGGAAGAAGG - Intronic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1171362729 20:24600466-24600488 AAGGGCAGCGATAAGGAGGAAGG - Intronic
1171461692 20:25301646-25301668 CAGGGCAGTACAGAGGAGGCCGG + Intronic
1171487986 20:25497707-25497729 CTGGGCTGTCAGCAGGAGGAAGG - Intronic
1172285903 20:33740248-33740270 CTGGGAAGTGGAAAGGAGGATGG + Intronic
1172955580 20:38755827-38755849 CAGAGCAGTCACAAACAGGAAGG - Intronic
1173849189 20:46207244-46207266 CAGTGCAGATAAAAGCAGGAGGG + Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1175829032 20:61952007-61952029 CAGGGCAGACAAAAGAGGCATGG + Intergenic
1176047346 20:63099753-63099775 GAAGGCAGCCAAAGGGAGGAGGG + Intergenic
1176448680 21:6842960-6842982 CAGGGATTTCAAACGGAGGAAGG + Intergenic
1176826850 21:13707983-13708005 CAGGGATTTCAAACGGAGGAAGG + Intergenic
1176892551 21:14335711-14335733 AAGGGCAGCAAAAAGTAGGATGG + Intergenic
1178070343 21:28958430-28958452 CAGAGCAGACAAATGTAGGAAGG + Exonic
1179091807 21:38272592-38272614 CAGGGTAGTGCAAAGGAAGAGGG + Intronic
1179337922 21:40475113-40475135 CACGACAGTCTGAAGGAGGAGGG - Intronic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1179721992 21:43321385-43321407 CAAGGCAGTGAAGGGGAGGAGGG - Intergenic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1185249223 22:49791011-49791033 CAGTGCAGTCAGGAGGAGCAGGG - Intronic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
950621526 3:14209500-14209522 CAGGGGAGTGTAATGGAGGAGGG - Intergenic
951657417 3:25025339-25025361 CAGACAAGTCAAAAGGAGAAGGG - Intergenic
952033382 3:29171548-29171570 CATGGCATTCAAAAGGAAGGAGG - Intergenic
952935607 3:38396250-38396272 CAGGGCAGTGCAGAGGAAGAAGG + Intronic
953274233 3:41479204-41479226 CAGGGGAGGAAAAAGGAGAAGGG - Intronic
953820162 3:46201414-46201436 CAAGGCAGTAAAAGGGAAGAAGG - Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
955615732 3:60804771-60804793 CAGGGCTGTGCAATGGAGGAAGG - Intronic
956426900 3:69145193-69145215 CCAGGCAGAAAAAAGGAGGAGGG + Intergenic
956749326 3:72333714-72333736 CAGGGGACTCCAAAGGAGGAGGG + Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
959063892 3:101638524-101638546 CAGGCCAGTAAAAATCAGGAAGG + Intergenic
959667833 3:108941516-108941538 CAGGGGAATGAAATGGAGGAGGG - Intronic
960198179 3:114796728-114796750 TAGGATAGTCAAAAGCAGGATGG + Intronic
960995057 3:123335247-123335269 CAGGGCAGTCAGGAGGCCGAGGG - Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
963928745 3:150979406-150979428 TAGGAAAGTAAAAAGGAGGAAGG - Intergenic
966060111 3:175743655-175743677 AAGGGTAGTGAAAAGGAGGTAGG + Intronic
966318130 3:178671607-178671629 CTGGTCAGTCAAAAGGTTGAGGG + Intronic
967067265 3:185929904-185929926 AAGGGGAGTCAAAACAAGGAAGG - Intronic
967938341 3:194747185-194747207 CAGGGCAGGCAAACGGAGCCCGG + Intergenic
967961367 3:194927926-194927948 GAGGGCAGTGAGATGGAGGAGGG - Intergenic
968134216 3:196209670-196209692 GATGGCAGTCAAAGGGAAGACGG + Intronic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
968739831 4:2321878-2321900 CAGGGCAGTCAGCAGGAGTGGGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969335209 4:6503936-6503958 AAGGGCAATCAAAAGCAGGTGGG + Intronic
969444936 4:7239332-7239354 CCTGGCAGTCCAAAGGAGGTCGG - Intronic
970050831 4:11913156-11913178 CAATGCAGGCAAAAGAAGGAGGG + Intergenic
974168456 4:58235044-58235066 CAGGTCAGTCAGAAGGGAGAAGG - Intergenic
975230255 4:71924314-71924336 TAGGGCAGTGAAAAGGGGAAAGG + Intergenic
976244091 4:82990150-82990172 CATGGCATTCTGAAGGAGGAAGG - Intronic
976355362 4:84110881-84110903 CAAGGGAGGAAAAAGGAGGAAGG - Intergenic
977830945 4:101592054-101592076 CAGGACAGGCAACAGGGGGAAGG - Intronic
981177903 4:141703215-141703237 GAGGGCAGACGAGAGGAGGAGGG - Intronic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
986127789 5:4899432-4899454 CAGGGAAGTCAGAAGGACCAGGG - Intergenic
986132306 5:4942813-4942835 CTGGGCTGTCAAAAGGAGAAGGG + Intergenic
986968418 5:13303219-13303241 CAGGGAAGTCTTAAGGAGGTAGG + Intergenic
987252922 5:16118854-16118876 CAGGGCAGTGAAGAGGTGGAAGG + Intronic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
987722146 5:21650833-21650855 AAGGAAGGTCAAAAGGAGGAAGG - Intergenic
987792713 5:22588824-22588846 CAGGGCAGTAAAAAGGAATGTGG - Intronic
992093210 5:73338039-73338061 CAGGGCAGTGATTAGGAGAAGGG - Intergenic
993525425 5:88959965-88959987 GAGGGAAGTCAATAGGAGCAGGG + Intergenic
995480161 5:112585321-112585343 CAGGGCAGTCCAGAGGCAGAGGG - Intergenic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
997379181 5:133423200-133423222 CAGAGCAGTCAAAAGGGGCCAGG - Intronic
997882921 5:137606301-137606323 CACTGCAGTCAGGAGGAGGATGG + Intergenic
999062470 5:148651280-148651302 CAAGGCAGTGAAAAGCAAGAGGG + Intronic
1000348528 5:160334179-160334201 CGAGGCAGTGAAAAGGTGGAGGG - Intronic
1000636986 5:163655788-163655810 CAGGGAGGTAAAAAGGAGGCTGG - Intergenic
1002713310 5:181208466-181208488 CACGGTAGCCAAAAGGAGGAAGG - Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003569567 6:7247130-7247152 CAAGGCAGACAAGAGGAAGAAGG + Exonic
1004118144 6:12791320-12791342 CAGGGCAGGAAATAGGAGCAAGG - Intronic
1004171369 6:13297830-13297852 AAGGGCAGTCAGAAAGATGATGG + Intronic
1004337414 6:14776940-14776962 CAGTTCAGTATAAAGGAGGAAGG - Intergenic
1004520263 6:16355161-16355183 CAGGCCAGTCCAAGGGAAGATGG - Intronic
1004773515 6:18814981-18815003 AAGAGCAGGCAAAAGGAAGAAGG - Intergenic
1006283838 6:33078168-33078190 CTGGGCAGTGAAAGGGAGGACGG + Intronic
1006297082 6:33174468-33174490 CAGGGAAGCGAAGAGGAGGAGGG + Intronic
1006655257 6:35586463-35586485 CAAGACAGTCTAAAGGAAGATGG + Intronic
1007582820 6:42969357-42969379 CAGGGCAGTAAAGTGCAGGATGG + Intronic
1007913798 6:45541707-45541729 CAGGGCAGAAAAAAGGAAGGGGG - Intronic
1010921399 6:81686147-81686169 CAGGGCAGTAACAATGAGGGTGG - Intronic
1012142091 6:95636765-95636787 CAGAGCAGACAAGAGGAGCAGGG + Intergenic
1013720505 6:113020955-113020977 AAGGGCAGAAAAAAGGTGGAAGG + Intergenic
1014711781 6:124814994-124815016 CAGGGCAGACAAAAACAGTAAGG - Intronic
1015582281 6:134738650-134738672 CAGGACAGTGAAAAGGAGGTAGG - Intergenic
1017545898 6:155450513-155450535 CAGGGCAGCCAAGAGGCGTAAGG + Intronic
1017873354 6:158504008-158504030 CGGGCCAGTGAGAAGGAGGACGG + Exonic
1018864232 6:167734965-167734987 GAGGAGGGTCAAAAGGAGGATGG + Intergenic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019842660 7:3463809-3463831 CAGGACAGGCCATAGGAGGAGGG + Intronic
1020740933 7:12017383-12017405 CATGGCAGAGGAAAGGAGGATGG + Intergenic
1021547986 7:21837561-21837583 CAGGGGAGGTAAAAGGAGGGAGG + Intronic
1022358746 7:29639918-29639940 CAGGCCAGTAAAAATCAGGAAGG - Intergenic
1022503458 7:30896669-30896691 GAGGGGAGGCAAAAGGAGGCAGG - Intergenic
1023276445 7:38523483-38523505 CAGGTCTGTCAAAAGGACAAAGG + Intronic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1030399326 7:109028606-109028628 CATGGCAGTCAGGAGGAGGTAGG - Intergenic
1031876729 7:127150307-127150329 CAGGGACTTCAAAAGGAGGCTGG + Intronic
1031909743 7:127503215-127503237 AATAGCAGTCAAAAGTAGGAAGG - Intergenic
1032433127 7:131879214-131879236 CAGGGCAGCCATGAGGAGTAAGG + Intergenic
1032481186 7:132248497-132248519 GAGGTCAGTCAAATGGAGGAGGG + Intronic
1032739521 7:134724817-134724839 GAGGGCAGTAGAAAGGAGGAAGG - Intergenic
1032763489 7:134967214-134967236 CAGGGCAGTACAAGGTAGGAGGG + Intronic
1034226754 7:149490536-149490558 CAGGGCAGTGAAAAGGCAGCAGG + Intronic
1035239687 7:157521492-157521514 CAGGGCAGTGAGTGGGAGGAGGG + Intergenic
1036037251 8:5032491-5032513 CAGGACAGTGATAAGGAGAAGGG + Intergenic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG + Intergenic
1041304363 8:56445459-56445481 CTGGGCTGTCAGAAGGAAGATGG - Intronic
1042125425 8:65533493-65533515 CATGGCCTGCAAAAGGAGGAAGG + Intergenic
1042141184 8:65680269-65680291 CAGGAGAGTCTAAAGCAGGAAGG - Intronic
1043314641 8:78905356-78905378 CAAGTGAGTTAAAAGGAGGATGG - Intergenic
1043699333 8:83265291-83265313 CAATGCAGTCAAAAGTAGAATGG - Intergenic
1044935822 8:97292599-97292621 CAAGGAATTCAAAAGGAGGTAGG - Intergenic
1045010160 8:97951815-97951837 CGGGGAAGGGAAAAGGAGGAAGG - Intronic
1045344640 8:101283086-101283108 CAGGCCAGAAAAAATGAGGAAGG - Intergenic
1045432811 8:102128979-102129001 CAGGGAAGTCCCAAGGTGGAAGG + Intergenic
1045516392 8:102864005-102864027 CAGCGCAGGCAAAAGAAGAAAGG + Exonic
1046699709 8:117386370-117386392 AAGGGCTGTCAAAGGGAGGAAGG - Intergenic
1049238775 8:141526001-141526023 CAGGGCAGTCATTAGCAGCATGG - Intergenic
1049429104 8:142550965-142550987 CAGGGCAGGGAAGAGGAGGGAGG + Intergenic
1049822124 8:144641831-144641853 CAGTGCAGCCACGAGGAGGAGGG + Intergenic
1050150196 9:2612279-2612301 CAGGGCATCTACAAGGAGGATGG - Intergenic
1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG + Intronic
1051042984 9:12837139-12837161 CAGAGAAGTAAAAAGGAGCAGGG - Intergenic
1051861410 9:21628992-21629014 CAAGGCAGGCAAAAGAAGGAGGG + Intergenic
1055587028 9:77765803-77765825 CACGACAGCCAAAAGGTGGAAGG + Intronic
1055636713 9:78286448-78286470 CAGAGCTGTGTAAAGGAGGAGGG + Intergenic
1055705008 9:78989340-78989362 CAGGGCATTAAAAAAGAGGTTGG + Intergenic
1055888680 9:81098471-81098493 CAGACCAGACAAAAGGAAGAGGG + Intergenic
1056543311 9:87592853-87592875 CAGGGCAGGCAAGAAGAGGCTGG - Intronic
1057227901 9:93302130-93302152 CAGGGCAGCCCAAAAGAGAAGGG + Intronic
1057330341 9:94108645-94108667 CTTGGCTGTCAAAAGGAGGCAGG + Exonic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1059202575 9:112431615-112431637 GAGGGCAGTACCAAGGAGGATGG - Intronic
1059302160 9:113322763-113322785 CAGGGCAGCAGAAAGGAGCATGG - Intronic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060386224 9:123231666-123231688 AATGGCAGTAAAAAAGAGGAGGG - Intronic
1061976796 9:134072497-134072519 AAAGACAGTCAAAAGGAGGCAGG + Intergenic
1203520509 Un_GL000213v1:41557-41579 CAGGGATTTCAAACGGAGGAAGG - Intergenic
1185787538 X:2903558-2903580 CCAGGCAGCAAAAAGGAGGAAGG - Intergenic
1186402671 X:9274014-9274036 GAAGGCAGTAGAAAGGAGGAAGG + Intergenic
1186865053 X:13711965-13711987 CAGGGCAGCCAAGAGCAGCAGGG - Intergenic
1188300217 X:28498442-28498464 CAGGTCAGGAAAAAGGAAGAAGG + Intergenic
1188935425 X:36170066-36170088 CAGAGCTGTCAAAAGGAGGATGG + Intergenic
1189108911 X:38266678-38266700 CCGGTCATTCAAAAGGAGAAAGG - Intronic
1189160354 X:38804017-38804039 CAGGGCAGAGCAGAGGAGGAGGG - Exonic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1190338784 X:49280020-49280042 CAGGGCAGTCAAGAGGAATGAGG - Intronic
1190636160 X:52435989-52436011 GAGGTCATTCAAATGGAGGAGGG + Intergenic
1190643571 X:52503895-52503917 TAGGTCATTCAAATGGAGGAGGG + Intergenic
1191684036 X:63870592-63870614 CAGGCCAGTAAAAAGAAAGAGGG + Intergenic
1192017299 X:67345544-67345566 AGGGGCAGTGAAAAGGAAGAAGG - Intergenic
1192476234 X:71445506-71445528 CAGGGCAATTCAATGGAGGAAGG - Intronic
1194847157 X:98824558-98824580 CTGGGCAGTTAAAGGGTGGAGGG + Intergenic
1199555449 X:149103310-149103332 CAGGGCTGTAAATAGGAGGACGG + Intergenic
1200770615 Y:7121731-7121753 AATGTCAGTCAACAGGAGGATGG - Intergenic
1201620662 Y:15953554-15953576 CAAGGTAGTCAAATAGAGGATGG + Intergenic
1201643425 Y:16202229-16202251 CAGGCCAGTAAAAATCAGGAAGG + Intergenic
1201659390 Y:16383092-16383114 CAGGCCAGTAAAAATCAGGAAGG - Intergenic