ID: 1184615385

View in Genome Browser
Species Human (GRCh38)
Location 22:45634498-45634520
Sequence TGCCAACACCCTTGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184615380_1184615385 5 Left 1184615380 22:45634470-45634492 CCTTATGTCACAGAGCATCCTTG No data
Right 1184615385 22:45634498-45634520 TGCCAACACCCTTGTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184615385 Original CRISPR TGCCAACACCCTTGTGTGGT GGG Intergenic
No off target data available for this crispr