ID: 1184620415

View in Genome Browser
Species Human (GRCh38)
Location 22:45672224-45672246
Sequence CGGGGCCGCCGCGGGAGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184620415_1184620434 21 Left 1184620415 22:45672224-45672246 CCGGGACTCCCGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 33
4: 240
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1184620415_1184620420 -10 Left 1184620415 22:45672224-45672246 CCGGGACTCCCGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 33
4: 240
Right 1184620420 22:45672237-45672259 GGCGGCCCCGGCCTGGACCCAGG 0: 1
1: 0
2: 9
3: 51
4: 407
1184620415_1184620430 18 Left 1184620415 22:45672224-45672246 CCGGGACTCCCGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 33
4: 240
Right 1184620430 22:45672265-45672287 CCCCCGCCTCGCTGGAGACGCGG 0: 1
1: 0
2: 0
3: 22
4: 125
1184620415_1184620427 10 Left 1184620415 22:45672224-45672246 CCGGGACTCCCGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 33
4: 240
Right 1184620427 22:45672257-45672279 AGGCGCCGCCCCCGCCTCGCTGG 0: 1
1: 1
2: 3
3: 38
4: 281
1184620415_1184620437 27 Left 1184620415 22:45672224-45672246 CCGGGACTCCCGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 33
4: 240
Right 1184620437 22:45672274-45672296 CGCTGGAGACGCGGAGGGCGAGG 0: 1
1: 0
2: 3
3: 18
4: 303
1184620415_1184620435 22 Left 1184620415 22:45672224-45672246 CCGGGACTCCCGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 33
4: 240
Right 1184620435 22:45672269-45672291 CGCCTCGCTGGAGACGCGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184620415 Original CRISPR CGGGGCCGCCGCGGGAGTCC CGG (reversed) Intronic
900127612 1:1075469-1075491 CAGGGCTGCCGCGGGCATCCTGG + Intergenic
900255060 1:1693532-1693554 CGGGGCTGCCGCGGGACATCCGG + Intronic
900263803 1:1746798-1746820 CGGGGCTGCCGCGGGACATCCGG + Intergenic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
900284156 1:1891264-1891286 CCGGGCCGCCGGGGGTCTCCCGG - Intergenic
900367880 1:2318674-2318696 TGGGGCCGGGGCGGGAGTCCAGG + Intergenic
900555076 1:3276291-3276313 TGGGCCCGCGGTGGGAGTCCTGG + Intronic
900713970 1:4132468-4132490 GGGGGCAGCAGCGGGAGACCGGG - Intergenic
901610789 1:10496330-10496352 CGAGGCCACCGTGGGAGTGCTGG - Intronic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903883802 1:26529880-26529902 CGGGGCCGCCGGAGGAGCGCGGG + Intronic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904334562 1:29788175-29788197 CAGGGCAGCCACGGGAGGCCAGG - Intergenic
905151355 1:35930754-35930776 CGGGGCCTCCGCGGCAGTTCGGG + Intronic
905886915 1:41496559-41496581 CAGGGCCCCCGCAGGGGTCCGGG - Intergenic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908401322 1:63774700-63774722 CCGGCCCGCCGCGGGGCTCCGGG - Intronic
910237200 1:85048275-85048297 CGGGGACGCCGCGGGAAGGCCGG - Intronic
918056055 1:181022870-181022892 GGGGGCCGGCGCCCGAGTCCGGG - Exonic
920010111 1:202861236-202861258 CGGGGACGCCCGAGGAGTCCCGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
924436783 1:244049184-244049206 CGGCGCAGCTGCGGGAGGCCCGG + Intronic
1062813871 10:485102-485124 CAGGGCCACCGCGGGAGGCACGG + Intronic
1063429766 10:5977977-5977999 CAGGGCCGCGGAGGGAGACCAGG - Intronic
1064384659 10:14879200-14879222 CGAGGCCGCCACGGGAGACGCGG - Intronic
1065727263 10:28677869-28677891 CGGGGGCGCCGCGGCCGTGCGGG + Exonic
1067585562 10:47474257-47474279 CGGGGCCACAGGGGGTGTCCTGG - Intronic
1069942431 10:71964664-71964686 CGGGGCCGCCGGTGGAGTCTCGG + Exonic
1070290709 10:75111653-75111675 CCGAGCCGCCGTCGGAGTCCGGG - Exonic
1070812057 10:79303225-79303247 GGAGGCCGAGGCGGGAGTCCAGG + Intronic
1072169926 10:92848905-92848927 CGGGGCCGCAGCGCGGGGCCCGG - Intronic
1073064033 10:100748109-100748131 AGGGGACACGGCGGGAGTCCAGG - Intronic
1075334351 10:121597894-121597916 CGTGGGCGCCACGGGAGCCCGGG - Intronic
1075522015 10:123148712-123148734 GGGGCCCGGCGCGGGAGTCTTGG - Intronic
1075802605 10:125161845-125161867 CCGGGCCGCCGCGCAAGCCCAGG - Intergenic
1076848536 10:133081852-133081874 CGGTGCTGCCGAGGGAGCCCTGG - Intronic
1077124428 11:926120-926142 CGGGGCCGCCGGCGGAGACGGGG + Intronic
1078317318 11:10304575-10304597 CGGCCCCTCCGCGGGAGTCTGGG + Intergenic
1078679550 11:13463042-13463064 CGGGGGCGGCGCGGGAGGCTGGG - Intronic
1080283619 11:30585465-30585487 TCGGGCCGCCGCGGGAGCCCGGG + Intronic
1082807645 11:57460766-57460788 CGGGGACCCCGCGGGGCTCCGGG - Exonic
1083033489 11:59615490-59615512 CGCGGCGGCGGCGGGAGGCCCGG - Exonic
1083741439 11:64713594-64713616 CGGGGCCGCCGCCGAACTCCAGG + Exonic
1083904826 11:65662767-65662789 CGGGGCCGCCGCGGCTGTGGCGG - Intronic
1083945101 11:65919180-65919202 CGGGGCCATCGCGGGAACCCCGG + Intergenic
1084044960 11:66563124-66563146 CGGGGCCCCGGCTGGAGCCCTGG + Exonic
1084128611 11:67118009-67118031 CGTGGCGGGCGCGGGAGGCCCGG - Intergenic
1084171242 11:67401908-67401930 CGGGGCGGGCCCGGGAGGCCTGG - Intronic
1085322586 11:75583837-75583859 AGGGGACGCCGCGGGAGACTGGG + Intergenic
1089453303 11:118611118-118611140 CGGGGCCAGAGCGGGAGTCAAGG + Intronic
1090385623 11:126356136-126356158 GGGGGCCGCCGCTTCAGTCCGGG - Intronic
1091550042 12:1530259-1530281 CGGGGCCGGCGCGGCTGTCGGGG + Intronic
1092229070 12:6766816-6766838 CGGGGCCGTCGGGGGCGGCCTGG - Intronic
1092253868 12:6915865-6915887 TGGGGTTCCCGCGGGAGTCCAGG - Exonic
1092861833 12:12725264-12725286 CGGGGCCGCGGCCGGAGCGCGGG - Intergenic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096840941 12:54379018-54379040 TGCGGCAGCCGCGGGAGTCAGGG + Intronic
1097029322 12:56080139-56080161 CGGAGCCGGAGCCGGAGTCCGGG - Exonic
1100331403 12:93585801-93585823 GGGGGCAGGGGCGGGAGTCCTGG - Intergenic
1101371710 12:104137563-104137585 CGGGGCGGCCGGGCGAGTCAGGG - Intronic
1101773726 12:107775300-107775322 GGGTCCCTCCGCGGGAGTCCGGG - Exonic
1102197192 12:111034068-111034090 CGGGGCCGCCGCCGGCCGCCCGG - Exonic
1102997448 12:117361207-117361229 CGCGGCGGCCGCGGGCGCCCGGG - Intronic
1103074269 12:117969310-117969332 CGGGGGCGGCGGGGGAGGCCGGG + Intergenic
1103764803 12:123272071-123272093 CGCGGCGGCTGCGGGAGGCCAGG + Exonic
1104841617 12:131828540-131828562 AGCGGCAGCCGCGAGAGTCCGGG - Exonic
1104949474 12:132432757-132432779 CGGAGCCGCCGGGGGCCTCCAGG - Intergenic
1105293900 13:19071855-19071877 CGGGGCCGCTGCTGGGATCCAGG + Intergenic
1105413839 13:20192804-20192826 CGGGGCCGGGGCGGGGGTCTCGG + Intronic
1105557416 13:21459548-21459570 CTGGGCGGACGCGGGAGGCCGGG + Intergenic
1111951219 13:94711191-94711213 CGGGGCCGCCTCGCGAGGACCGG - Exonic
1112505166 13:99970904-99970926 CCGGGCCGCCGCTGCCGTCCGGG + Exonic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1112506986 13:99981388-99981410 CGGGGCGGCAGGCGGAGTCCAGG - Intergenic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1116817855 14:49599766-49599788 CGGGGCCGGGGCGGGGATCCGGG + Intronic
1116887040 14:50231643-50231665 CGCGGCCGTAGCGGGAGTCGGGG - Intergenic
1116945397 14:50831028-50831050 CGGCGCCGCCGCGGGAACCATGG + Exonic
1121645882 14:95516732-95516754 CGGGGCCACCGGGCGGGTCCCGG - Intronic
1121758669 14:96424242-96424264 CGGGAGTGCCGCGGGAGGCCAGG + Intronic
1122269665 14:100562988-100563010 CGGGGCCCACGCGGGAGACTTGG + Intronic
1122529804 14:102417841-102417863 GGAGGCTGCCACGGGAGTCCAGG + Intronic
1122615252 14:103013283-103013305 CGGGACCGCCATGGGTGTCCAGG - Intronic
1125575869 15:40755134-40755156 GGGGGCCGCGGCGGAAGGCCAGG - Exonic
1127268041 15:57376751-57376773 GGGGCGCGGCGCGGGAGTCCGGG - Intronic
1128062036 15:64741317-64741339 CGGTGTCCCCGCTGGAGTCCTGG + Intronic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1129761542 15:78131642-78131664 GGGTCCCGCCGTGGGAGTCCAGG + Intronic
1131144434 15:90002030-90002052 CGGCGGCGGCGCGGGAGGCCCGG + Intronic
1132321914 15:100931637-100931659 TGGGGCTGGCGCGGGAGGCCAGG + Intronic
1132805503 16:1773359-1773381 GGAGGCCGCCGCGAGAGCCCGGG + Exonic
1132833913 16:1943025-1943047 CGGGGGCGCCGCCGTCGTCCGGG - Intronic
1132857509 16:2053388-2053410 CGGAGCGGCCGCTGGAGGCCCGG + Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1133739241 16:8639397-8639419 AGGGGCCGCCGCCAGTGTCCGGG - Intronic
1136428285 16:30183504-30183526 GGCGGCCGCAGCGGGAGCCCGGG + Exonic
1137609681 16:49810138-49810160 CGGGGAGGCTGGGGGAGTCCTGG + Intronic
1139598123 16:67969635-67969657 CGGGCCCGCTGCGGGGGCCCTGG - Intergenic
1140946223 16:79770649-79770671 CTGGGCCGCGGCTGGAGCCCGGG - Intergenic
1142631716 17:1229850-1229872 CGGAGCCGCCGGGGGAGGGCGGG + Intergenic
1143155533 17:4833777-4833799 CCCAGCCGCGGCGGGAGTCCGGG - Intronic
1143510834 17:7394320-7394342 TGGGGCCCCCGAGGGAATCCAGG - Exonic
1143539696 17:7561775-7561797 CGGGGCCGCCACGCGCGGCCGGG + Intergenic
1144819049 17:18058644-18058666 TGGGGCCCCAGCTGGAGTCCAGG + Intronic
1145747772 17:27332843-27332865 CGCGGCCGGCGCAGGCGTCCAGG + Intergenic
1146787457 17:35732035-35732057 CGGGGCCGCCACGTGAGAGCTGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148911384 17:50944816-50944838 CGGGGCCGCCGCAGGAGCGCAGG - Intergenic
1148930148 17:51120937-51120959 GCGGGGCGCCGCGGGAGGCCAGG + Intergenic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152783687 17:82237393-82237415 CGGGGCCGCCGCGACCCTCCCGG + Exonic
1152789863 17:82273190-82273212 CGGGGTCTCCGCGCAAGTCCCGG - Intronic
1152864983 17:82717010-82717032 AGGGGCGGCGGCGGCAGTCCCGG - Intronic
1152921378 17:83068192-83068214 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921392 17:83068226-83068248 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921555 17:83068668-83068690 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921625 17:83068842-83068864 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1155284207 18:24271875-24271897 CGGGCGCGGCGCGGGAGTCCTGG - Intronic
1158938351 18:62384947-62384969 CGGGGCCGCCGCACGGGTCCGGG - Exonic
1160390180 18:78524025-78524047 CGAGGACGCCGCGGGTGTTCTGG - Intergenic
1160500781 18:79400357-79400379 CGGGGCCGGGGCGGGAGCCGGGG - Intronic
1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG + Intronic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1163243305 19:16077037-16077059 CGGGGCTGGCGCCGGGGTCCCGG + Intronic
1163596994 19:18226158-18226180 TGGGGCCGGGGCCGGAGTCCGGG - Intronic
1163651696 19:18521665-18521687 CGGGCCCGGCGCGCGAGTCTGGG + Intronic
1163708624 19:18832374-18832396 CGGTGGCGGCGCGGGAGGCCCGG + Exonic
1164699725 19:30276091-30276113 CAGGGCCACCGGGGGAGTGCAGG + Intronic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1165443902 19:35846150-35846172 CGCGGCTGCCGCAGGAGTCGCGG - Exonic
1165721410 19:38082116-38082138 CGGGGGAGCCGCGGGGGGCCCGG + Exonic
1167272072 19:48511445-48511467 CGAGGCCGCCGCGGGGGTGGGGG + Intronic
1167494301 19:49808864-49808886 CGGGGCCGGCGGGGGAGGTCGGG + Intronic
1167578333 19:50328320-50328342 CGGCGCCGCCGCCCGCGTCCTGG + Exonic
1168187827 19:54710698-54710720 TGGGGCCGCCAGGGGAGCCCAGG - Intergenic
1168336282 19:55599408-55599430 CGGGGCCGCCCCGGGTCTCCAGG - Intronic
1168336289 19:55599418-55599440 CGGGGCGGCCCCGGGAGGCCGGG + Intronic
925609439 2:5691788-5691810 CAGGGCCGCCGCGGGGCTACCGG + Intergenic
925927195 2:8678960-8678982 CGGGGCCGGAGCCGGAGCCCCGG - Exonic
926190038 2:10721578-10721600 CGGGGCCGCCTCCAGAGCCCGGG + Intergenic
927690506 2:25204669-25204691 CGGGGCCCGGGCGGGCGTCCGGG - Intergenic
928278059 2:29920537-29920559 CGGGGCCGCCGCTGCAGCCCCGG - Exonic
929501379 2:42493933-42493955 CGGGGCGGCCGCCGGATTCGCGG - Exonic
929966840 2:46542822-46542844 CGGGGCCGGGGCGGGGATCCGGG + Exonic
929983017 2:46698990-46699012 CGGGGGCGGCCCGGGAGTCGGGG - Exonic
931348999 2:61471358-61471380 CGCGGCCGCGGGGGGAGTCCGGG + Intergenic
932571337 2:72940034-72940056 AGGGGCCCCTGCGGCAGTCCTGG - Intergenic
932699647 2:73984483-73984505 CGGGGGCGCCGGGGCTGTCCCGG + Intergenic
933769609 2:85734691-85734713 CAGGGCTGCTGCGGGAGCCCAGG + Intergenic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
936433268 2:112482241-112482263 CCGGGCCGCGGCGGGCGCCCGGG + Exonic
938301121 2:130213696-130213718 CGGGGCCGGGGCGGGGATCCTGG - Intergenic
938455595 2:131460771-131460793 CGGGGCCGGGGCGGGGATCCTGG + Intergenic
938876080 2:135532117-135532139 TGGGGCGGCCGGGGGAGCCCGGG - Intronic
946422518 2:219572531-219572553 CGGGGCAGCCGCCTGACTCCAGG - Exonic
947745041 2:232503107-232503129 CCTGGCCGCTGCGGGACTCCTGG + Intergenic
948115732 2:235493727-235493749 GGGGGCCGCCGCGAGAACCCGGG + Intergenic
948248696 2:236507641-236507663 CTGCGCCACCGCGGGAGGCCTGG + Intergenic
948690014 2:239696062-239696084 CAGGGCAGCCGCAGGGGTCCTGG - Intergenic
948910259 2:240999121-240999143 GGCGGCGGCGGCGGGAGTCCGGG - Intronic
1168777721 20:462212-462234 CGGGGCTGCTGCGGGGTTCCGGG - Intronic
1169143492 20:3238662-3238684 CGGCGCCGCGGTGGGAGCCCCGG - Intronic
1170460571 20:16573406-16573428 TGGGGCTGCCGCGGAACTCCAGG - Exonic
1172240587 20:33410147-33410169 CCGGGCCGCCGAGGGTGTGCAGG - Exonic
1172367910 20:34363731-34363753 CGGGGCCGGCGCGGGCGACGTGG + Intronic
1172587129 20:36092747-36092769 CGGGGCAGCCGCCGGACACCAGG + Intronic
1175399655 20:58693100-58693122 CGGGGCCTCCGCGGGCCGCCCGG - Intronic
1180092882 21:45541995-45542017 CGGGGTCTCCGCGGGGGTCGCGG - Intronic
1180681271 22:17628557-17628579 CGAAGCCGCGGCGGCAGTCCCGG - Intronic
1181058757 22:20272077-20272099 CGGGGCTGCAGAGGGTGTCCTGG + Intronic
1181652915 22:24270827-24270849 CGGGGCCCGCGAGGGAGGCCGGG + Exonic
1183486110 22:38088637-38088659 CGAGGCCCCCGGGGGAGGCCAGG + Intronic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184730720 22:46369662-46369684 TGGGGCCTTCACGGGAGTCCGGG - Intronic
1185296781 22:50058520-50058542 CGGGGCCGCAGCGCGTGACCCGG - Intergenic
950441961 3:13015622-13015644 CGGGGCCGCAGAGGCAGGCCAGG - Intronic
950729800 3:14947689-14947711 CGGGGGCGCCGCCGGGGTCGCGG - Intronic
952644409 3:35639003-35639025 CGGGGGCGCCCCTGGACTCCTGG - Intronic
953518822 3:43622082-43622104 CGGGGCCGCGGCGGGAGAGGCGG + Intronic
954680974 3:52345773-52345795 CGGGGCTGCAGCGGAAGGCCAGG + Intronic
960586119 3:119322866-119322888 CGGCCCGGCCGCGGGGGTCCCGG + Intronic
960702410 3:120451131-120451153 CGGGGAGCCCGCGGGAGTCCTGG + Exonic
961081521 3:124032922-124032944 CGGGGCCGCCGGGCGAGCCCGGG - Intergenic
961551665 3:127673228-127673250 GGGGGCTGCGGCGGGGGTCCGGG - Intronic
968010439 3:195270858-195270880 CGAGGGCGCGGCGGGAGCCCCGG + Exonic
968048151 3:195635438-195635460 GGGGGCGCCCGCGGGGGTCCGGG - Intergenic
968048177 3:195635500-195635522 GGGGGCGGCCGCGGGGGTCGGGG - Intergenic
968081470 3:195849518-195849540 TGGGGCTGCCCCGGGAGGCCCGG - Intergenic
968099227 3:195954120-195954142 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968099253 3:195954182-195954204 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
968133631 3:196207469-196207491 CGTGTCCGCCGCGGGCCTCCTGG - Exonic
968306434 3:197654421-197654443 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968306460 3:197654483-197654505 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
968550586 4:1221725-1221747 CGGGGCCGCCACGGGAGAAGGGG + Intronic
969756494 4:9153419-9153441 CGCGGGGGTCGCGGGAGTCCAGG + Intergenic
972265269 4:37453743-37453765 CGGGGCCGGGGTGGCAGTCCCGG - Intergenic
972533102 4:39977751-39977773 CGGGCGGGCCGCGGGGGTCCCGG - Exonic
973292435 4:48483672-48483694 CGGGGCCGGCGCTGGAGGCAGGG - Exonic
976199023 4:82561565-82561587 CGGGGCCGCAGCGGGCGGGCTGG + Intronic
979278093 4:118835839-118835861 CGGGGACGCGGCGGGAGGCCGGG - Intronic
979919505 4:126479619-126479641 CGGGGCCCCAGCGGCAGCCCTGG - Intergenic
980355475 4:131729250-131729272 CAGGGCCTGCGCGCGAGTCCAGG - Intergenic
981504213 4:145482144-145482166 TGGGGCCGCCGCGGTCGTGCTGG + Intronic
981964083 4:150580125-150580147 CGGGGAGGCCGCGTGCGTCCCGG - Intronic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
985660862 5:1155923-1155945 CGGGGCGGGCGCGGGAGGCCGGG + Intergenic
985894432 5:2740155-2740177 TGGGGCCGCCGGGGCAGTCGTGG + Intergenic
990308799 5:54518558-54518580 CCGAGCCGCCGCGGGAACCCAGG - Exonic
990383022 5:55233852-55233874 CCGGGTCGCTGCGGGAGCCCGGG + Intergenic
994175117 5:96702719-96702741 CGGCCCCGCCCCGGGAGCCCGGG - Intronic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997521283 5:134525894-134525916 TGGGGCCGGCGCGGGAGGGCGGG - Intronic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
999727025 5:154446036-154446058 AGGGGCTGCCGCGGGACTCGGGG + Exonic
1001381979 5:171311318-171311340 CGGGGCCGCCGGCGGGGCCCCGG - Intronic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002895583 6:1378382-1378404 CTGTGCCGCCTCGCGAGTCCTGG + Intergenic
1003087110 6:3068884-3068906 CGGGGCGGCCGCGGGCTTCCCGG + Intronic
1003212360 6:4079167-4079189 CGGGGGCGCCCGGGGAGGCCCGG + Exonic
1003390328 6:5707895-5707917 GGGTGCCGCCGTGGGAGCCCGGG + Intronic
1004216935 6:13711763-13711785 CGGGGGCGACGCGGGAGCGCGGG + Intergenic
1006580112 6:35072250-35072272 CGGGTCGGCCCCGGGCGTCCTGG - Intronic
1007347130 6:41239694-41239716 CTGCGCCCCCGCGGGAGCCCGGG - Intergenic
1010327999 6:74587614-74587636 TGGGGCAGCCGAGGGAGTGCTGG + Intergenic
1011195067 6:84772964-84772986 GGGCTCCGCCGCGGGAGCCCGGG + Intergenic
1015496645 6:133889859-133889881 CGGGGCTGCAGCTGCAGTCCAGG + Intronic
1015994782 6:138987356-138987378 CTTGGCCGCGGCGCGAGTCCAGG + Intronic
1018091225 6:160348228-160348250 CGGGGCTGCTGCGGGCGCCCGGG + Intergenic
1018856468 6:167678762-167678784 CGGGGGCGGGGCGGGAGGCCGGG - Intergenic
1018945789 6:168346013-168346035 CGGGGCAGCCGGGGGAAGCCGGG + Intergenic
1019663896 7:2241915-2241937 CGGGGCCGGCGGCGGAGTCCAGG - Intronic
1019733931 7:2641308-2641330 CGGGGCAGTCGGGGGAGTCTGGG + Intronic
1022018579 7:26376708-26376730 CGGGGCCGGGGCTGGACTCCAGG + Intergenic
1022427953 7:30285551-30285573 CGGGGCCGCCGCGGCCGCCGCGG - Exonic
1031899470 7:127392930-127392952 CAGGGCCGCGGCCGGAGTCTCGG + Intronic
1032068796 7:128791508-128791530 CGGAGCCGGCGCGGGAGCCGCGG + Intronic
1034222777 7:149459496-149459518 CGGGGGCGGCGGGGGAGGCCGGG - Intronic
1034306502 7:150048482-150048504 CGGGGGCGGTGGGGGAGTCCCGG + Intergenic
1034800345 7:154052161-154052183 CGGGGGCGGTGGGGGAGTCCCGG - Intronic
1034911566 7:155002666-155002688 CGGGGTGGGCGCGGGAGGCCCGG - Intronic
1036849833 8:12193925-12193947 CGCGGGGGTCGCGGGAGTCCAGG - Intronic
1036871197 8:12436198-12436220 CGCGGGGGTCGCGGGAGTCCAGG - Intronic
1038449936 8:27633632-27633654 GGAGGACGCCGCGGGAGCCCGGG + Intergenic
1042246425 8:66712867-66712889 CCGGGCCGCCGTCGGAGTCCCGG - Intronic
1044781652 8:95749923-95749945 CGGGGCCGCTGCAGGAGTCCTGG + Intergenic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1049585125 8:143429427-143429449 CGGGGCGGCCCCGGGAGCGCGGG - Exonic
1049607139 8:143534945-143534967 GGGGGCTGCCGCGGGAGGGCAGG - Intronic
1049726192 8:144147606-144147628 CGGGCGGGCCGCGCGAGTCCAGG + Intergenic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1060192035 9:121599510-121599532 CCGGGTGGCCGCGGGAGCCCGGG + Intronic
1060537102 9:124399347-124399369 TGGGGCCAAGGCGGGAGTCCTGG + Intronic
1060587394 9:124795139-124795161 CGGGGCTGCCGCCAGAGGCCAGG + Intronic
1061450196 9:130663555-130663577 CGGGGCCGCAGCGGCCGTCGGGG - Intergenic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061843714 9:133375602-133375624 CGGGCCGGCGGCGCGAGTCCTGG - Intronic
1061987155 9:134136353-134136375 AGGGGCCGGGGCGGGGGTCCCGG - Intronic
1062519026 9:136950021-136950043 CGGGGCTCCCGGGGGAGTCCTGG - Intronic
1062578812 9:137220917-137220939 CGGGGCCGCCGTGGCAGTGGCGG + Exonic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1185892827 X:3835720-3835742 AGGGGCCGCGGCGGCTGTCCCGG - Intronic
1185897935 X:3874140-3874162 AGGGGCCGCGGCGGCTGTCCCGG - Intergenic
1185903054 X:3912571-3912593 AGGGGCCGCGGCGGCTGTCCCGG - Intergenic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1187669849 X:21657272-21657294 CGCGGGCCCCGCGGGACTCCTGG - Exonic
1188005497 X:25013547-25013569 AGGGGCCGCCGCGGCAGCCGCGG - Exonic
1193665351 X:84309643-84309665 AGGGGCAGCCCCGGGAGTGCTGG + Intergenic
1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG + Exonic
1200218360 X:154378722-154378744 CGGGGCCCGCGCGGGAGTCAGGG - Intergenic
1200218387 X:154378829-154378851 CGGGGCCCGCGCGGGAGTCAGGG - Intergenic
1200218473 X:154379141-154379163 CGGGGCCCGCCCGGGAGTCAGGG - Intergenic
1200229407 X:154436792-154436814 CGGGGCCGCGCCGAGACTCCCGG + Intergenic