ID: 1184620434

View in Genome Browser
Species Human (GRCh38)
Location 22:45672268-45672290
Sequence CCGCCTCGCTGGAGACGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184620419_1184620434 12 Left 1184620419 22:45672233-45672255 CCGCGGCGGCCCCGGCCTGGACC 0: 1
1: 0
2: 4
3: 31
4: 364
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1184620426_1184620434 -10 Left 1184620426 22:45672255-45672277 CCAGGCGCCGCCCCCGCCTCGCT 0: 1
1: 1
2: 6
3: 91
4: 751
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1184620422_1184620434 2 Left 1184620422 22:45672243-45672265 CCCGGCCTGGACCCAGGCGCCGC 0: 1
1: 0
2: 2
3: 29
4: 361
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1184620415_1184620434 21 Left 1184620415 22:45672224-45672246 CCGGGACTCCCGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 33
4: 240
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1184620425_1184620434 -9 Left 1184620425 22:45672254-45672276 CCCAGGCGCCGCCCCCGCCTCGC 0: 1
1: 0
2: 5
3: 97
4: 580
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1184620423_1184620434 1 Left 1184620423 22:45672244-45672266 CCGGCCTGGACCCAGGCGCCGCC 0: 1
1: 0
2: 4
3: 30
4: 327
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1184620421_1184620434 3 Left 1184620421 22:45672242-45672264 CCCCGGCCTGGACCCAGGCGCCG 0: 1
1: 0
2: 1
3: 15
4: 246
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1184620418_1184620434 13 Left 1184620418 22:45672232-45672254 CCCGCGGCGGCCCCGGCCTGGAC 0: 1
1: 0
2: 4
3: 23
4: 325
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1184620424_1184620434 -3 Left 1184620424 22:45672248-45672270 CCTGGACCCAGGCGCCGCCCCCG 0: 1
1: 0
2: 4
3: 81
4: 572
Right 1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184620434 Original CRISPR CCGCCTCGCTGGAGACGCGG AGG Intronic
903925240 1:26826937-26826959 CCGCCGCGCTGGAGCAGCAGCGG + Exonic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
906590962 1:47023825-47023847 TCTCCTGGCTGGAGACGCGCTGG + Exonic
912381934 1:109252353-109252375 CCGCATCGATGCAGACACGGGGG + Exonic
914004213 1:143718215-143718237 CTGCCGCGGTGGAGCCGCGGGGG + Intergenic
1071618068 10:87094601-87094623 CCGCCTCGCTGTAGTGGCGCCGG + Exonic
1074095064 10:110304640-110304662 CCGCCTCGCCGGAGACGCCCAGG - Intronic
1077285463 11:1763493-1763515 CAGCCTCCCTGGAGACGGGGCGG - Intronic
1083723704 11:64617636-64617658 CAGCCTCGCTGGAGACCCCATGG - Intronic
1084784536 11:71434563-71434585 CCTCCTCGCTGGAGAAGGTGTGG + Exonic
1087039526 11:93784821-93784843 CCCCATCGCGGGAGAGGCGGAGG - Intronic
1087755141 11:102047420-102047442 CCGTTTCCATGGAGACGCGGCGG - Intergenic
1089540209 11:119185390-119185412 CCGCCTCCTTGAAGACGCTGTGG - Intergenic
1093406404 12:18810055-18810077 CTGGCTCTGTGGAGACGCGGTGG + Intergenic
1094025876 12:25959079-25959101 CCGGGGCGCTGGGGACGCGGCGG - Exonic
1094536536 12:31326344-31326366 CCGCGGCGCGGGAAACGCGGCGG + Exonic
1108408199 13:50125003-50125025 CCGCCTTGCTGGGGTCGAGGAGG - Intronic
1113856999 13:113452259-113452281 CCGGCTTGCTGGAGACGGGGAGG - Intronic
1114637405 14:24195625-24195647 CCGCCTCGCCGAAGACGGGCGGG - Intronic
1117549099 14:56816764-56816786 CCGCCCCGCTGGAGGCGCCGGGG + Intergenic
1121616975 14:95319891-95319913 CCGCGGAGCTGGAGTCGCGGCGG + Exonic
1122082444 14:99274785-99274807 CCGCCTCTCGGGAGAAGAGGAGG - Intergenic
1123030019 14:105447187-105447209 CTGGCTCGCTGGAGAAGCAGTGG + Intronic
1132368669 15:101277448-101277470 GCGCCCGGCTGGAGGCGCGGCGG - Exonic
1132634710 16:938106-938128 CCGCCTCGCAGGAGAGGGGGTGG + Intronic
1136478301 16:30526571-30526593 CCGGCGCGCTGGAGAGGCGCGGG - Exonic
1139466233 16:67155526-67155548 CCCCCTCGCGGTAGGCGCGGAGG + Exonic
1141086076 16:81096369-81096391 CCGGCTGGATGGAGGCGCGGAGG + Exonic
1141456416 16:84145228-84145250 CCGGCGCGCTGGGGACGCCGGGG - Intergenic
1142246990 16:88974779-88974801 TCGCCTGGCTGGAGGAGCGGGGG - Intronic
1142670651 17:1486025-1486047 CCGGGTCGGTGTAGACGCGGCGG - Intronic
1144816617 17:18039641-18039663 CCGCCGCGCGGGAGCCGAGGAGG - Exonic
1147793037 17:43025174-43025196 CCGCCTGGCTGGGGGCGGGGCGG + Intergenic
1151702293 17:75749967-75749989 CCGCGTCTCTGGAGACCTGGTGG - Intronic
1152229715 17:79108398-79108420 TCGCCTAGCTGGAGATGCGTGGG - Intronic
1157279041 18:46333973-46333995 CGGCCTCGCCGGAACCGCGGGGG - Intronic
1158427398 18:57352492-57352514 CAGCCTCGCTGGAAACGCGCGGG + Exonic
1161038032 19:2096299-2096321 CCGCCTCGCAGCCGCCGCGGAGG + Exonic
1163443394 19:17333151-17333173 CCTCCTCGCAGGAGAAGCCGCGG + Exonic
1163466359 19:17470444-17470466 GCGGCTCGCTGTAGAGGCGGGGG + Exonic
1166996088 19:46720308-46720330 CAGCCTCGCTGGAGGTGCAGAGG - Exonic
1168337009 19:55602637-55602659 CCGCCTCGCGGAAGCGGCGGGGG - Exonic
1168544691 19:57240676-57240698 CCGCCTCCCTGGCGGCGCTGGGG + Intronic
932760516 2:74436456-74436478 CCGCCGCGATGGAGTCTCGGTGG - Intronic
941951488 2:171160824-171160846 CCGCCTCCCGGGCGACGCCGGGG - Exonic
942882165 2:180873454-180873476 GCGCCGCGCTGGAGCAGCGGCGG + Intergenic
947156199 2:227164651-227164673 GCGCTGCGCAGGAGACGCGGTGG + Exonic
949070357 2:242020777-242020799 CCGTGTAGCTGGAGGCGCGGTGG + Intergenic
1175308390 20:57993900-57993922 CCGTCTCGCTGGAGAACAGGAGG + Intergenic
1179796720 21:43789345-43789367 GCGCCTCGCTGGGGCTGCGGTGG - Intergenic
1179822969 21:43947456-43947478 AGGCCTCGCTGGAGATGCCGGGG - Intronic
1183601488 22:38843094-38843116 CTTCCTCGCTGGCGAGGCGGGGG - Intronic
1184620434 22:45672268-45672290 CCGCCTCGCTGGAGACGCGGAGG + Intronic
953326133 3:42013774-42013796 ACGCCTCGCTTGAGGCGCGCGGG - Intergenic
954735810 3:52705831-52705853 CCGTCGCCATGGAGACGCGGGGG + Exonic
967975702 3:195033694-195033716 CCGCCTCACTGCATACTCGGAGG + Intergenic
968088501 3:195885413-195885435 CCGCATCGATGGAGCCGCAGGGG + Intronic
968097452 3:195941531-195941553 CCGCGCAGCTGGAGACTCGGGGG + Intergenic
968764715 4:2462424-2462446 CCACCTGGCGGGCGACGCGGCGG - Exonic
975778698 4:77818658-77818680 TCGCCTCTCAGGAGACGCGGAGG + Intronic
1001342672 5:170862083-170862105 CCGCCACGCTGGGAACCCGGCGG + Intronic
1002045309 5:176538077-176538099 CCGCCACGCTGGGGGCGTGGCGG - Intergenic
1003624048 6:7726915-7726937 ACGCCTCGCGGGATCCGCGGGGG + Exonic
1012211306 6:96521845-96521867 CTGACTCGCAGTAGACGCGGAGG - Exonic
1022739796 7:33109645-33109667 CCGCCTAGCTGGAGCCGAAGCGG + Intergenic
1031966446 7:128031248-128031270 CCGGCTCGCTCCAGCCGCGGGGG + Intronic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1035751597 8:2000970-2000992 CCTCCTCGCTGGAGAGGAGAGGG + Exonic
1036751379 8:11445609-11445631 CCTCCTCTCTGGAGATGGGGAGG - Intronic
1037884539 8:22589306-22589328 CGGCCGCGCTGGCGACTCGGCGG + Exonic
1038781974 8:30575731-30575753 CCGCCTCGCTGCAGAAGGCGCGG + Intergenic
1039990499 8:42483505-42483527 CCGCCTTGCTGGAGAGTCTGAGG + Intronic
1050512949 9:6413655-6413677 CAGCCTCGCTAGGGGCGCGGCGG - Intronic
1057035888 9:91811387-91811409 CCCCCTCACTGGAGAAGCGCTGG - Intronic
1057234248 9:93346245-93346267 CGGCGGCGCTGGAGACCCGGCGG + Exonic
1060601248 9:124879480-124879502 CAGCCTCGATGGAGACACTGGGG - Exonic
1192962490 X:76145327-76145349 CCGCCTCCCCGAAGAGGCGGTGG + Intergenic
1192963043 X:76149760-76149782 CCGCCTCCCCGAAGAGGCGGTGG - Intergenic
1197709337 X:129654644-129654666 CCGGCTCGCCGGGGCCGCGGCGG - Exonic