ID: 1184631299

View in Genome Browser
Species Human (GRCh38)
Location 22:45782348-45782370
Sequence GCCATGAACACAAACGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184631295_1184631299 9 Left 1184631295 22:45782316-45782338 CCCGTAGAAATGAGTGCTCGTGT 0: 1
1: 1
2: 0
3: 7
4: 95
Right 1184631299 22:45782348-45782370 GCCATGAACACAAACGTTCATGG No data
1184631296_1184631299 8 Left 1184631296 22:45782317-45782339 CCGTAGAAATGAGTGCTCGTGTC 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1184631299 22:45782348-45782370 GCCATGAACACAAACGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184631299 Original CRISPR GCCATGAACACAAACGTTCA TGG Intronic
No off target data available for this crispr