ID: 1184632849

View in Genome Browser
Species Human (GRCh38)
Location 22:45798686-45798708
Sequence AAGAAAAATCAGATGCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184632847_1184632849 -3 Left 1184632847 22:45798666-45798688 CCAGAGCAACTCACTAAGCCAAG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1184632849 22:45798686-45798708 AAGAAAAATCAGATGCATGCAGG 0: 1
1: 0
2: 3
3: 32
4: 487
1184632846_1184632849 20 Left 1184632846 22:45798643-45798665 CCAGTAAACAACGTGCTGAAGGT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1184632849 22:45798686-45798708 AAGAAAAATCAGATGCATGCAGG 0: 1
1: 0
2: 3
3: 32
4: 487
1184632844_1184632849 25 Left 1184632844 22:45798638-45798660 CCACTCCAGTAAACAACGTGCTG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1184632849 22:45798686-45798708 AAGAAAAATCAGATGCATGCAGG 0: 1
1: 0
2: 3
3: 32
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184632849 Original CRISPR AAGAAAAATCAGATGCATGC AGG Intronic
900040175 1:454714-454736 TAGAAAAATGAGTTGAATGCTGG - Intergenic
900061604 1:689688-689710 TAGAAAAATGAGTTGAATGCTGG - Intergenic
900195992 1:1375684-1375706 AAAAAAAATAAGACGCAGGCTGG + Intergenic
900293439 1:1935708-1935730 AAGAGAAATCAGAGGCAAGTAGG + Intronic
900588130 1:3443472-3443494 AAGAAAAATAAAATACATGAAGG - Intergenic
901707263 1:11083578-11083600 AAAAAAAATTAGATATATGCAGG + Intronic
901793598 1:11667585-11667607 AAAAAAAATCAGATGGAGGGTGG - Intronic
902522017 1:17024178-17024200 AAGAAAATTCACATGCAAGTAGG - Intronic
902907400 1:19568494-19568516 AAGAAAAACCATATCCAGGCCGG - Intergenic
902996528 1:20229757-20229779 TAGAAAACTCAGGTGCAGGCCGG + Intergenic
903440717 1:23386025-23386047 AAGAAGAATCAGACTCATGGCGG - Intronic
905287533 1:36891681-36891703 AAGAAAAATAAGAGGCATGGGGG + Intronic
905474351 1:38215275-38215297 AAGAAAAATAAAATGGATGGGGG - Intergenic
905618608 1:39420369-39420391 AAGAAAAATCAGATAGAGGCAGG - Intronic
906106287 1:43294788-43294810 ATAAAATTTCAGATGCATGCTGG + Intergenic
907395509 1:54187008-54187030 AAGAAACATCAGCTTCATGTGGG - Intronic
908736204 1:67279396-67279418 ATGGAAAAGCAGATCCATGCTGG - Intergenic
908991383 1:70094741-70094763 AACAATACTCAGAGGCATGCGGG + Intronic
909068623 1:70965161-70965183 AAAAAAAATCAGAGCCTTGCAGG + Intronic
909436551 1:75648632-75648654 AAAAAACATCAGAAGCATGAAGG - Intergenic
909541644 1:76798402-76798424 AAAAAAAGTTAAATGCATGCAGG - Intergenic
909722369 1:78790263-78790285 GAGAAAAAGCAGATGAATTCTGG - Intergenic
910307929 1:85787880-85787902 AAGAAACAACAGATACTTGCAGG - Intronic
910325290 1:85999672-85999694 AAGAAAAAAAAGATTCATCCTGG + Intronic
910368002 1:86487214-86487236 AATAAAACACAGATGCACGCAGG - Intronic
911094656 1:94045585-94045607 GAGAGAAAGCAGATGGATGCAGG + Intronic
912029157 1:105217452-105217474 AAGGAAAATTAGATGCATCTGGG - Intergenic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
916872134 1:168927188-168927210 AATAAATATCTAATGCATGCAGG - Intergenic
916952357 1:169794002-169794024 AAGAAAAAGCAGCTGTATGGTGG - Intronic
917113814 1:171580817-171580839 AAGAAAAATAAGTTACATTCAGG + Intronic
917404550 1:174690818-174690840 AAAAAAAAAAAGATGAATGCTGG - Intronic
917653439 1:177102078-177102100 AAGAGAAATCAGACACATTCAGG + Intronic
918261739 1:182802452-182802474 AAAAAAAATCTGATGCATCTAGG - Intronic
918289189 1:183090241-183090263 AAAAAAAAGCAGATGCATCTAGG + Intronic
918393386 1:184089728-184089750 AAAAAAAATCAAATGCAAGAAGG + Intergenic
918691450 1:187485390-187485412 GAGAAAACTCAGGTGGATGCTGG + Intergenic
919536252 1:198791341-198791363 AACAAAAAACAAATGCCTGCAGG + Intergenic
919586036 1:199441755-199441777 AAGAAAAATCTGTTACATGAGGG - Intergenic
922094061 1:222426368-222426390 AATAAAAATCAAAAGCAAGCAGG + Intergenic
922341587 1:224660845-224660867 ATGGAAAAGCAGATCCATGCTGG + Intronic
923223039 1:231913651-231913673 AAGTAAACTCAGATGACTGCTGG - Intronic
924206570 1:241717999-241718021 AAGAAAACTCAGATGCAGAGAGG + Intronic
924299649 1:242624671-242624693 AAGAAAAAGCAAATGCCAGCTGG + Intergenic
924655104 1:245967471-245967493 AAGAAAAGTCAAATGCATAGGGG + Intronic
1063770360 10:9190796-9190818 AACAAAAATGAGAAGCATACAGG + Intergenic
1064737218 10:18394421-18394443 CAAAAACATCAGATGCATGTAGG + Intronic
1065094894 10:22271032-22271054 AAGAAACATAAGATGCTGGCTGG + Intergenic
1065873190 10:29973807-29973829 AACAAAAATCTGATCCAGGCTGG - Intergenic
1066405831 10:35117136-35117158 AAGAAGCAACAGATGCCTGCAGG + Intergenic
1066488567 10:35872481-35872503 AGGTAAAATCAGATCCATGTGGG + Intergenic
1066659968 10:37728947-37728969 AGGAAGCACCAGATGCATGCTGG + Intergenic
1067229879 10:44398780-44398802 ATGAAAAATTAGCTGCATTCAGG - Intergenic
1067235033 10:44439862-44439884 CAGAAACATCAGATGGAAGCTGG - Intergenic
1067532592 10:47085396-47085418 AGGGAAAATGAGATGCATGGAGG + Intergenic
1067900837 10:50239980-50240002 TACAAAAATCAGTTGCATGCTGG - Intronic
1068018767 10:51553097-51553119 AACAAAGTTCAGATGCATTCAGG - Intronic
1068787793 10:60995850-60995872 AAAAAAAATCAGGTTCAAGCAGG + Intronic
1069204150 10:65660704-65660726 AAGATAATTCAGAAGAATGCTGG - Intergenic
1070012671 10:72492090-72492112 AAGAAAAATCATATACTGGCGGG - Intronic
1070263200 10:74877929-74877951 AAGAAAAAAAAAAAGCATGCTGG + Intronic
1070364914 10:75727175-75727197 AAGAAAAATCAGGTGAAGGATGG - Intronic
1071839757 10:89457470-89457492 AAGAAACAACAGATGCTAGCAGG + Intronic
1072853200 10:98918992-98919014 AAGAAAAATAAGATACAGCCTGG + Intronic
1074057723 10:109937833-109937855 AATAAAAATCACTTGCAAGCAGG + Intergenic
1074148281 10:110736476-110736498 AAGAAAATTCAGATGAAAACAGG - Intronic
1074330326 10:112500662-112500684 AAGCAAACTCAGATGCCTACAGG - Intronic
1074888620 10:117715841-117715863 GAGAAATACCTGATGCATGCAGG + Intergenic
1075121169 10:119666069-119666091 CAGAAAAATGAGAGGCATGTGGG - Intronic
1076048174 10:127311839-127311861 AATAAAAAACAGGTACATGCAGG - Intronic
1076966396 11:90619-90641 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1077510493 11:2958473-2958495 AAGAAAAAGCAGAAGCATAAGGG - Exonic
1078130650 11:8611559-8611581 AATAAAAATAAGAAGCAGGCTGG + Intergenic
1078398676 11:11003935-11003957 AATAAAAATCAGAACCCTGCTGG + Intergenic
1078696342 11:13635946-13635968 GAGAAACATCAGATGCAGGAAGG + Intergenic
1079757993 11:24290023-24290045 AAGAATTTTGAGATGCATGCTGG + Intergenic
1080095866 11:28405898-28405920 AAGAAAGATCAGATGGTTGTAGG + Intergenic
1080207001 11:29741350-29741372 GACAAAAATTAGATTCATGCTGG - Intergenic
1080786624 11:35480812-35480834 AACAAATATCTAATGCATGCAGG - Intronic
1081192616 11:40122370-40122392 AAGAAATAGCTAATGCATGCGGG - Intronic
1081834235 11:46140801-46140823 AAGAAAAGACAGATCCATGGAGG - Intergenic
1081842197 11:46210687-46210709 AAGAAAAAACAGATGCTAGAGGG - Intergenic
1083125958 11:60565865-60565887 ATGAAAAATCTTATGGATGCTGG - Intergenic
1084343863 11:68529515-68529537 ATTTAAAAACAGATGCATGCCGG - Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086314175 11:85572667-85572689 AAGAAACATGAGATGAATGCAGG + Intronic
1086641487 11:89162957-89162979 AGGAAAAAACAGATGAATGCTGG + Intergenic
1087728485 11:101751461-101751483 AGGAAAAATCATATCCAAGCAGG - Intronic
1089056669 11:115591222-115591244 AAAAAAAATCATATGCTTGGGGG - Intergenic
1089974980 11:122724538-122724560 AGGAAAAATCAGAGGACTGCGGG + Intronic
1091547587 12:1512871-1512893 AAGAAACATCAGATTTAAGCTGG + Intergenic
1092030579 12:5280300-5280322 AAGAGCAATCTGATGCATCCCGG - Intergenic
1092277787 12:7075302-7075324 AAGGAAAATAACAGGCATGCAGG - Intergenic
1092938764 12:13387790-13387812 AGGAAAGATCAGACGTATGCTGG + Intergenic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093970115 12:25368879-25368901 AAGAAAAATTAAATGGATGGAGG + Intergenic
1094120455 12:26968489-26968511 TGTAAAAATCAGATGCATACGGG + Intergenic
1094535100 12:31314196-31314218 AAGAAAAATCAGATCCAGCCTGG + Intronic
1095133917 12:38574918-38574940 AAGAAACATCAGACGTAGGCAGG + Intergenic
1095289709 12:40463808-40463830 AACAAATAAAAGATGCATGCTGG + Intronic
1095730287 12:45498940-45498962 AAGAAAAACCATATGTAGGCTGG - Intergenic
1095762195 12:45851973-45851995 AAGGAAAATGAAATGCATGTGGG + Exonic
1095878306 12:47105572-47105594 AAGGAAAATAAAATGCATGAGGG + Intronic
1096698799 12:53368504-53368526 AAGAAAAATTAGCTGAGTGCAGG + Intergenic
1096918787 12:55061564-55061586 AGGAAAAGTCAGATTCATGGAGG - Intergenic
1096945598 12:55405444-55405466 AAGAAGAATCAGAGACCTGCTGG - Intergenic
1096973925 12:55687784-55687806 AAGATAAATCAGATGCAGGCTGG - Intronic
1097121878 12:56739825-56739847 AAGAGAAATAAAAGGCATGCTGG - Intronic
1097239297 12:57564038-57564060 GAGACAACTCAGATGTATGCAGG - Intronic
1099118370 12:78656191-78656213 AAGAAAAATTAGAAACAAGCTGG + Intergenic
1099237007 12:80093965-80093987 TACAAAAATCAGATGGATCCTGG + Intergenic
1099359750 12:81685465-81685487 AGGAAAATTCAGATTCAGGCTGG - Intronic
1099900294 12:88699447-88699469 AAGAAATATAAAATGCAGGCTGG - Intergenic
1100614980 12:96224029-96224051 AATACAAATGAGATGCAGGCAGG + Intronic
1100982970 12:100177612-100177634 AAGAAAACTCAGAACCAAGCAGG + Intergenic
1102464546 12:113120763-113120785 AAGAAAAATCAGATGGAAGATGG - Intronic
1102662135 12:114538455-114538477 AAGAAAAATTAGCTGCATATAGG - Intergenic
1102896660 12:116603669-116603691 GAGAAAAACCAGATGCCTGATGG + Intergenic
1102958052 12:117072251-117072273 AAAAAAAAGCAGGTGCAAGCAGG - Intronic
1104148783 12:126061798-126061820 AAGAAAAATCATTTGCAGTCTGG - Intergenic
1104497591 12:129255424-129255446 AAGAGAAATCAGATTCCTCCTGG - Intronic
1105389684 13:19963132-19963154 TAAAAAAATCACATGCAGGCCGG - Intronic
1105967067 13:25394687-25394709 AAGAAACATCAGATGCAGAAAGG + Intronic
1106801037 13:33255937-33255959 AAGAAAGAGCACATGTATGCAGG + Intronic
1106899953 13:34345093-34345115 AAATAAAATCAGATGCATAGGGG - Intergenic
1107033892 13:35880710-35880732 GAGAAAAAACAGATGCCTTCTGG - Intronic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1108528579 13:51306886-51306908 AAATAAAATCAGATACATGGAGG + Intergenic
1108645783 13:52426228-52426250 GAGAATAATTAGATGTATGCAGG - Intronic
1108650043 13:52469025-52469047 AAGAAATAGCAGATGCTGGCAGG - Intronic
1108793635 13:54003762-54003784 AAGCAAAATCATATGTATGTTGG + Intergenic
1109521274 13:63513395-63513417 ATGAAAAATCAGATACTTTCTGG - Intergenic
1110718996 13:78740189-78740211 AAGAAAAAGGAGATGCATAGAGG + Intergenic
1110839911 13:80130080-80130102 AAGAAAAATAAGAGGATTGCTGG + Intergenic
1111183651 13:84700350-84700372 AAAAAATATCTAATGCATGCTGG + Intergenic
1111334027 13:86798106-86798128 AAAAAAAATCACAATCATGCAGG + Intergenic
1113084491 13:106554327-106554349 AAGAAGAATGAGAAGCATTCTGG - Intronic
1113283819 13:108823087-108823109 AAGAAAAATCAGAAAAATGATGG - Intronic
1114831514 14:26148275-26148297 AAGAAAAAACAGATGTTGGCAGG + Intergenic
1115322398 14:32097276-32097298 AAGGAAAATCATATCCATGTTGG + Intronic
1116251524 14:42489663-42489685 AAGAAAAAGCAGATGAAATCTGG - Intergenic
1116515652 14:45802003-45802025 AAGAAACACCAGATGCATCTAGG + Intergenic
1117249463 14:53921962-53921984 AAGAATAATCAGATACATGGTGG - Intergenic
1117864956 14:60137401-60137423 AAGAAAAACCAGATGCAGTTAGG + Exonic
1118375534 14:65173664-65173686 AAGGAAAATCAGAAGCAGACAGG + Intergenic
1119289876 14:73487226-73487248 AAGAAAAATGAGATGAATTAGGG + Intronic
1119841260 14:77794817-77794839 AAGAAAACTCAGAGGCTGGCGGG - Intergenic
1119974312 14:79008618-79008640 AAAAAAAATCAGATTCATTGGGG - Intronic
1121147797 14:91600678-91600700 CAGAAAAATGAGATTCATGCTGG + Intronic
1121565068 14:94903318-94903340 AAAAAAAATCTACTGCATGCTGG + Intergenic
1122011116 14:98748784-98748806 GAGAAAAATTAGAGCCATGCAGG + Intergenic
1124717655 15:32080635-32080657 AAGAAACAACAGATGCTGGCAGG + Intronic
1127280286 15:57484673-57484695 AAGAAATACCTAATGCATGCGGG - Intronic
1128832343 15:70781001-70781023 AAGAAAAAGAAGATGCATCGGGG - Intergenic
1130054859 15:80513735-80513757 AAAAAAAATCAAAGGCATGCAGG + Intronic
1130716243 15:86337735-86337757 GGGAAAAAGCTGATGCATGCTGG + Intronic
1130914395 15:88293446-88293468 AAGAAAGAGGAGATGGATGCAGG + Intergenic
1131787268 15:95926507-95926529 AAGAAAAGTCAGAACCAGGCCGG + Intergenic
1132441732 15:101872906-101872928 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1134434274 16:14241175-14241197 AAGAAAAAACAGCTGGATGCTGG + Intronic
1134759900 16:16705086-16705108 TAGAAAAATGAAATGCAGGCTGG + Intergenic
1134986172 16:18654119-18654141 TAGAAAAATGAAATGCAGGCTGG - Intergenic
1137387514 16:48055303-48055325 AATAAAAATCAGATCCATGAAGG - Intergenic
1138421218 16:56900503-56900525 AATAAAAATCAGATGCTAGATGG - Intronic
1138943855 16:61823375-61823397 ATGAAAGATTAGATGCATGCTGG - Intronic
1139155028 16:64430946-64430968 AAGAAGAATCTGATGTATTCAGG + Intergenic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1141341815 16:83210461-83210483 AAGAGAAATCAGAAACATGGAGG + Intronic
1144095272 17:11894674-11894696 GAGAAGAAGCAGGTGCATGCTGG + Intronic
1144132084 17:12255760-12255782 AAGAACAATCAGCTGAAAGCAGG - Intergenic
1146432391 17:32810020-32810042 AAGCAAAAGCAGTGGCATGCAGG + Intronic
1147201704 17:38806692-38806714 AAGCAAAAACAAATGCCTGCTGG + Intronic
1147553365 17:41460732-41460754 AACAAATATCTAATGCATGCAGG + Intronic
1147749756 17:42722951-42722973 AGGAAAGAGCAGATGCATGATGG - Intronic
1149024381 17:52009297-52009319 AACAAAAATTAGATGGATCCTGG - Intronic
1149898442 17:60450137-60450159 AAGAAAACACTGATGCAGGCTGG + Intronic
1150113377 17:62521719-62521741 AAAAAAAATCTCATGCATGAGGG - Intronic
1150186126 17:63183190-63183212 ATGGAAAAGCAGATCCATGCTGG - Intronic
1151143964 17:72021641-72021663 TAAAAAAAACAGATGCTTGCAGG + Intergenic
1151191108 17:72398799-72398821 AAAAAAAAAAAGATGCATCCTGG + Intergenic
1156084041 18:33377738-33377760 GACAAAAATGAGATGGATGCAGG + Intronic
1157054025 18:44203770-44203792 TAGAAAATTCAGAAGCATGTAGG + Intergenic
1157419680 18:47535957-47535979 AAGAAAAACAAGATGCATAGAGG + Intergenic
1157562788 18:48660446-48660468 AAGAATAAACACATACATGCAGG + Intronic
1158097113 18:53785777-53785799 AGGAAAGATCAGAGGCATGGTGG + Intergenic
1158564929 18:58546743-58546765 AGGAAAACACAGATGCATGCAGG - Intronic
1158841219 18:61389871-61389893 AAGAGAAAGGAGATGCTTGCAGG - Intronic
1159135730 18:64334864-64334886 AAGAAAGAACAGATGGGTGCTGG - Intergenic
1160021408 18:75184698-75184720 AAAAAAAATCATATGCAAGATGG - Intergenic
1160643199 19:160241-160263 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1162156466 19:8681423-8681445 AAGGGTAATCAGATGCATGTGGG + Intergenic
1162653074 19:12106514-12106536 AAAAAAGATCAGGTGCATTCAGG - Intronic
1163476303 19:17527988-17528010 ACTAAAAATAAGATGCAGGCTGG - Intronic
1164645387 19:29855411-29855433 AAGATAAGGGAGATGCATGCTGG + Intergenic
1165292836 19:34903105-34903127 AAGAGAAATAAAAGGCATGCAGG + Intergenic
1165372372 19:35417269-35417291 AAGAGAAAGCACATGCATGCAGG + Intergenic
1166018712 19:40004943-40004965 AAAATAAAAAAGATGCATGCAGG - Intronic
1166018718 19:40004998-40005020 AAAAAAAAAAAGATGCATGCAGG - Intronic
1167151424 19:47712527-47712549 AACAAAAATTAGCTGGATGCAGG - Intergenic
1167265601 19:48481464-48481486 AAAAAAAATCAGAAGCGTGCTGG - Intronic
1167987036 19:53327384-53327406 AAGAAAAATCGAATGAATTCAGG + Intergenic
1168488925 19:56791019-56791041 AAGAAAAAACAGATTAATGAAGG - Intronic
925001425 2:405916-405938 GAGAAAACTCAAATGCCTGCAGG + Intergenic
925220153 2:2132606-2132628 AACAAATATCCAATGCATGCGGG + Intronic
925453838 2:3996503-3996525 AACACCAATCAGAAGCATGCTGG - Intergenic
925487802 2:4355311-4355333 AAGAAAACACAGATGTATGGGGG + Intergenic
925858179 2:8150478-8150500 AAGGAAATCCAGCTGCATGCTGG + Intergenic
928615387 2:33033490-33033512 GTGAACAATCAGATGCAAGCGGG + Intronic
928720303 2:34113597-34113619 AAGAAAATTCAGATGAAAGTGGG - Intergenic
928879123 2:36077261-36077283 AAGAAAAATCAGAGAAAGGCAGG + Intergenic
929327606 2:40636135-40636157 AAGAAAAAATAAATGCATGGTGG - Intergenic
929628689 2:43435808-43435830 AAGAAAAAAGAAATGCATGAGGG + Intronic
929748246 2:44681815-44681837 AACAAAAACCAGATGAATGAAGG - Intronic
931196912 2:60060505-60060527 AAGAAAAGAAAGATACATGCAGG - Intergenic
931538532 2:63303978-63304000 AAAAAAAAACAGATGTAGGCAGG + Intronic
931561105 2:63561862-63561884 AAGAAACAACAGATGCTGGCGGG + Intronic
932276750 2:70457400-70457422 AAGAAGAATCACATGCTTGGGGG - Intronic
932852790 2:75202217-75202239 AAGAAAAAGCATATTCATGATGG + Intergenic
932861762 2:75300431-75300453 AAGAGATATAAGATGCATTCTGG + Intergenic
933050895 2:77600658-77600680 GAGGAAATTAAGATGCATGCAGG - Intergenic
933518433 2:83336394-83336416 AAGATAAATTAGATCTATGCAGG - Intergenic
933841679 2:86291885-86291907 CAGAAAAGTCTGATGCAAGCAGG + Intronic
935531134 2:104233937-104233959 ACCAAACATCAGATGAATGCTGG - Intergenic
935574884 2:104698922-104698944 GAGAAAAATCACATGCAGTCTGG - Intergenic
935581986 2:104763938-104763960 AAAAAAAATAAGATGCAAGAAGG - Intergenic
936583497 2:113728541-113728563 AAGGAAATACAGTTGCATGCAGG - Intronic
937371308 2:121299434-121299456 TACAAAAATCAGCTGAATGCGGG - Intergenic
938130649 2:128713389-128713411 AAGAAGAATCAAATTCATGCTGG - Intergenic
939130651 2:138232258-138232280 AAGAAAGATCAGAAGTATGGGGG + Intergenic
939492475 2:142893098-142893120 AGGAAAAATGAAATGCATGTAGG + Intronic
940292650 2:152092264-152092286 AAGAATAATCATATGCCTACAGG - Intronic
941217107 2:162725863-162725885 ATGAAAAATCTGAAGCATGGGGG - Intronic
941513779 2:166446362-166446384 AGGAAACAACAGATGCAGGCAGG + Intronic
941582080 2:167310771-167310793 AAGAAAAAAAAGAAGCCTGCTGG + Intergenic
942037600 2:172025701-172025723 AAAAAAAATCTGATGGATGTTGG - Intronic
942300167 2:174553526-174553548 AATAAAAATGAAATGGATGCAGG + Intergenic
942424180 2:175841796-175841818 AACAAAACTCAGATGCATCAGGG + Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
943298982 2:186173527-186173549 AAGAAAAATAATATTCATGCAGG + Intergenic
943822252 2:192340310-192340332 AAGAAAAATCAATGGTATGCAGG + Intergenic
943927807 2:193810310-193810332 AAGGAATATTAGATACATGCAGG + Intergenic
944706383 2:202293170-202293192 TAGAACAATCGGATGAATGCAGG + Intronic
945460457 2:210101881-210101903 CAGGAAAATTAGATGCAAGCAGG + Intronic
946317366 2:218925805-218925827 AAAAAAAATCAGCTGCATTTTGG + Intergenic
947070069 2:226279220-226279242 AGGACAAATCAGCTGCATCCTGG + Intergenic
947122666 2:226834356-226834378 ATGAAAAGTCAAATGAATGCGGG - Intergenic
947235259 2:227934968-227934990 AACAAATACCTGATGCATGCAGG - Intergenic
947258805 2:228197547-228197569 AAGAAAAATAAAATACATGAGGG + Intergenic
947361970 2:229354892-229354914 AAGAATCATCAGATGCTTTCAGG - Intergenic
1169155744 20:3328170-3328192 AAAAAAAAACAGAGCCATGCAGG - Intronic
1169610196 20:7370622-7370644 AAGAAAAAGCTAATGAATGCTGG + Intergenic
1169850143 20:10039588-10039610 AATAAACTTCAGATGCATTCAGG + Intronic
1170113868 20:12836104-12836126 AAACAAAAGCAGATGCTTGCTGG - Intergenic
1170858400 20:20079082-20079104 AAGAAAAATCAGATGAACTTTGG + Intronic
1172202643 20:33137670-33137692 ATGAAAAGTCAGATACATGGTGG - Intergenic
1173123427 20:40315078-40315100 AAAAAAAATTAGATTCATGGAGG - Intergenic
1173148223 20:40543806-40543828 AAGGTGAATCAGATGCAGGCAGG - Intergenic
1173613242 20:44386145-44386167 AAAAAAAATCAGATGGTGGCTGG - Intronic
1174073438 20:47915073-47915095 AAGAAAAATAAAACGCCTGCAGG + Intergenic
1174980028 20:55383489-55383511 ATGACAAATCTCATGCATGCTGG + Intergenic
1176337991 21:5616670-5616692 GAGTAAAATCAGTTGGATGCTGG - Intergenic
1176339399 21:5679743-5679765 GAGTAAAATCAGTTGGATGCTGG - Intergenic
1176471653 21:7111896-7111918 GAGTAAAATCAGTTGGATGCTGG - Intergenic
1176495214 21:7493674-7493696 GAGTAAAATCAGTTGGATGCTGG - Intergenic
1176505428 21:7644713-7644735 GAGTAAAATCAGTTGGATGCTGG + Intergenic
1176880879 21:14191661-14191683 AAGAGAAATGAGATGGATTCAGG - Intronic
1178499823 21:33116483-33116505 TAGAAAGACAAGATGCATGCTGG + Intergenic
1178675652 21:34629451-34629473 AATAAAAAACAGGTGCATGGTGG - Intergenic
1179356491 21:40665181-40665203 AAGAAAACACAGAGGCAGGCTGG + Intronic
1181182447 22:21077608-21077630 AAAAAAAAAAAGATGTATGCGGG - Intergenic
1182912504 22:33996860-33996882 AACAAAAATAAGAAGCAGGCTGG - Intergenic
1183129838 22:35823353-35823375 AAGAATAAGCAGATGCCTGTTGG - Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1184632849 22:45798686-45798708 AAGAAAAATCAGATGCATGCAGG + Intronic
1184825980 22:46951433-46951455 AAGAATAATCAAGAGCATGCAGG + Intronic
1184892045 22:47386098-47386120 GAGATAAACAAGATGCATGCTGG + Intergenic
1185377848 22:50490319-50490341 AACAAAAAACAAATGCAGGCTGG + Intronic
950244050 3:11399049-11399071 TTTAAAAATCAGATGCAGGCTGG + Intronic
950349692 3:12336253-12336275 AAGATACATCAGATTAATGCTGG + Intronic
950484100 3:13262738-13262760 AAGGAAATTCTGATCCATGCTGG + Intergenic
951535272 3:23734898-23734920 TACAAAAAACATATGCATGCGGG - Intergenic
951637537 3:24796133-24796155 AAGATAAATCAGATCTATACAGG - Intergenic
952697536 3:36286311-36286333 AAGAAAAATCAAATTCATAAAGG + Intergenic
953950581 3:47186615-47186637 AAAAAACATCAGATGGATCCTGG - Intergenic
954487606 3:50868366-50868388 AAGAAAAAACAAAAGCAGGCCGG - Intronic
955176754 3:56622745-56622767 GTGTAAAATCAGATGCTTGCAGG - Exonic
955342312 3:58134544-58134566 AAGAAAAGTCAGATGCAGCTGGG + Intronic
955426249 3:58794284-58794306 AAGACAAATCAGATGCAATTTGG - Intronic
956147197 3:66202396-66202418 AAGAAATACCAAATGCATGTGGG + Intronic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
957436832 3:80188370-80188392 AAATAAAAAAAGATGCATGCTGG - Intergenic
957538528 3:81537797-81537819 AAGAATAAGCATAAGCATGCAGG - Intronic
957585322 3:82125142-82125164 CAGAAAATTCAGATGAATTCTGG + Intergenic
957751656 3:84426582-84426604 AAGAAAAATAGGATGGAGGCTGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958094837 3:88930696-88930718 AAAAACATTCACATGCATGCAGG - Intergenic
958458701 3:94366354-94366376 AAGAAACAACAGATGCTGGCAGG - Intergenic
959089182 3:101884142-101884164 AAGAAAAACGAGATGCCAGCTGG + Intergenic
959090888 3:101901429-101901451 AAGAAAGATGAGAAGCATTCTGG - Intergenic
959320160 3:104863370-104863392 AAAAAAAATCAAATGGAGGCTGG + Intergenic
959450153 3:106488622-106488644 AAAAAAAAACAGATGCAAACGGG - Intergenic
959830706 3:110858291-110858313 AAGAAGAATAAGATGGGTGCAGG + Intergenic
960757824 3:121036456-121036478 GAGAAAAATAAAAAGCATGCAGG - Intronic
960904092 3:122581462-122581484 AATAAAAATCAAAAGCATGGTGG - Intronic
961935975 3:130584311-130584333 AAGAAAAATCAGATGACAGAAGG + Intronic
962779689 3:138700585-138700607 AAGAAAAAAGAGATGAATGGGGG + Intronic
963461781 3:145623316-145623338 TAGAAAAAAAATATGCATGCTGG - Intergenic
963960751 3:151306196-151306218 AAGAAAAATCAGGCGTTTGCAGG - Intronic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964535853 3:157720219-157720241 AAAAAAAAACAGATGCTTGTGGG - Intergenic
965120004 3:164542112-164542134 AAAAAAAAACAGATGGATTCTGG + Intergenic
966573404 3:181473065-181473087 AACAAATACCTGATGCATGCAGG - Intergenic
967576755 3:191103835-191103857 AAGAAACATCAAATGCAAGAGGG + Intergenic
968828389 4:2916153-2916175 AATAATAATAATATGCATGCTGG - Intronic
969883634 4:10196156-10196178 AAGACCATTCAGACGCATGCTGG - Intergenic
970258064 4:14190419-14190441 AAGAAAAATCACTTTCATTCAGG + Intergenic
970266607 4:14295211-14295233 TAGGAAAATCAGATGAATGATGG - Intergenic
970785855 4:19795065-19795087 AAGTAAAATCTGCTGCATGAAGG - Intergenic
972742278 4:41898812-41898834 AAGAAAAATCTGATACATGTGGG + Intergenic
973102364 4:46289047-46289069 AAAAAAAAACAGATGCTGGCAGG + Intronic
973284303 4:48398160-48398182 AAGAAACAACAGATGCTGGCTGG - Intronic
974623625 4:64393853-64393875 AATAAAAATAATATGCATGATGG - Intronic
974669473 4:65010274-65010296 AATAAAAATCAGAAGCCTGAAGG + Intergenic
974863641 4:67553397-67553419 CAGAAAAATTAGATGCCTACAGG + Intergenic
974888019 4:67844180-67844202 AAGAAAATTAAGTAGCATGCTGG + Intronic
975868296 4:78749152-78749174 AAAAAAAATCAGAAGGATGAAGG + Intergenic
975931507 4:79529426-79529448 AATACAAATCAGAGGCCTGCTGG - Intergenic
976343256 4:83968452-83968474 AACAAAAATCAAATGCATATAGG - Intergenic
976960191 4:90961248-90961270 AAGAAACATTTGATGAATGCTGG - Intronic
977320355 4:95506806-95506828 AAAGAAAATCAGATGTATCCTGG - Intronic
978074642 4:104513447-104513469 TAGAAAACTCAGATGGATCCTGG + Intergenic
983888409 4:173006181-173006203 AAGAAAAAGCAGCTGCTTGCAGG - Intronic
984078182 4:175209106-175209128 AAGAAACAGCAGATGCAGGAAGG - Intergenic
984568108 4:181355646-181355668 AAGAAATAGCTAATGCATGCTGG - Intergenic
984794441 4:183645353-183645375 AAGAAAAATCTGAGACATGTAGG + Intronic
985009740 4:185570164-185570186 AGGAGAGATGAGATGCATGCAGG + Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
986287690 5:6372047-6372069 AAGAAAAATCAGTTTAATGTGGG - Exonic
986458113 5:7940720-7940742 AGGAAAAGACACATGCATGCTGG - Intergenic
986541663 5:8851021-8851043 AAGAAAAATAAGAAGCAGCCCGG - Intergenic
986546100 5:8898920-8898942 AACAAAGAAAAGATGCATGCTGG + Intergenic
986653545 5:9988713-9988735 AAGAAAATCCATATGGATGCTGG + Intergenic
986809707 5:11343371-11343393 AAGAAAAATAAGGTAGATGCCGG + Intronic
986914970 5:12608311-12608333 AAGAAACAACAGATGCTGGCAGG - Intergenic
986959141 5:13191994-13192016 AAGAGAGGCCAGATGCATGCAGG + Intergenic
987535311 5:19179538-19179560 AATAAAAATCAGATGTATTTGGG + Intergenic
988163058 5:27545704-27545726 ATCAAAAATCAGCTGCATGAAGG + Intergenic
988651532 5:33157159-33157181 AAAAAAAATCAGATGGTTACAGG + Intergenic
989503208 5:42193639-42193661 AGGAGAAATCAGATGCCTCCTGG - Intergenic
989672161 5:43931421-43931443 AAGAAACAACAGATGCTGGCAGG - Intergenic
989946935 5:50247218-50247240 CAGAAAAATTAGAAGCATGTTGG - Intergenic
990450143 5:55925888-55925910 AGGAAAAATGACAGGCATGCAGG + Intergenic
991719648 5:69483377-69483399 AAGAAAAAACAAAGGCATGATGG + Intergenic
991937017 5:71811920-71811942 AAGAAGAAAGAGATCCATGCAGG - Intergenic
991943369 5:71876437-71876459 TATAAAAATCACATGCAGGCCGG - Intergenic
992387190 5:76295899-76295921 ATGGAAAATCAGATTCATACTGG + Exonic
993127357 5:83851583-83851605 AAGAAAAACCAGATGCAGGCCGG - Intergenic
993296108 5:86143244-86143266 AAGAAAACTTAAATGCATGAAGG - Intergenic
993335164 5:86648146-86648168 AATAAAAATTACATGAATGCAGG - Intergenic
993650441 5:90514193-90514215 CAGAAAAATGAGACTCATGCTGG - Exonic
994289968 5:98017523-98017545 AAGAGAAATCAGATGTATTTTGG - Intergenic
994578397 5:101609873-101609895 AAGAAAAATCAGGTGCTAGCTGG + Intergenic
994926801 5:106126446-106126468 AAAACAAATCAGTTGAATGCAGG + Intergenic
995203095 5:109447975-109447997 ATGGAAAAACAGATCCATGCTGG + Intergenic
995349563 5:111159536-111159558 GACAAATATCTGATGCATGCGGG - Intergenic
995504095 5:112840844-112840866 AAGAAGACGCAGATGCTTGCTGG - Exonic
996706616 5:126504655-126504677 AAGAAAAATGACATGAAAGCAGG + Intergenic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
997493236 5:134297246-134297268 AAGAAAAATCACACTCTTGCTGG - Intronic
997576770 5:134984810-134984832 AAAAAAAAAAAAATGCATGCAGG - Intronic
997653778 5:135540489-135540511 AAGTAAAATCACATCCCTGCTGG - Intergenic
997841435 5:137244287-137244309 TAGAAAATTCAGATTTATGCTGG + Intronic
998566836 5:143223438-143223460 AACAAACATCAGTTGCATGGAGG - Exonic
999508153 5:152219882-152219904 AACAAATACCTGATGCATGCAGG - Intergenic
1000203870 5:159038465-159038487 AAAAAAAATCAAATGCAGGGTGG + Intronic
1000215316 5:159149680-159149702 AAGAACAATACGATGCATGTTGG - Intergenic
1000586423 5:163104851-163104873 AAGTAAAATGAGATGTATGAAGG + Intergenic
1000739504 5:164950006-164950028 AAGAAAAATCAGATTCATCTTGG - Intergenic
1001205372 5:169757212-169757234 TAGCAAAATCAGATGACTGCAGG - Intronic
1001645859 5:173281884-173281906 AAAATAAATCAGGTGCATGGGGG - Intergenic
1002587037 5:180255493-180255515 GAGAAAATTCAGATGCCTGATGG + Intronic
1002733672 5:181364229-181364251 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1002750869 6:109889-109911 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1003195512 6:3910601-3910623 AAGACATATCAAATTCATGCGGG - Intergenic
1004849289 6:19680485-19680507 AAGAAATAACAGAAGAATGCGGG + Intergenic
1004976955 6:20978927-20978949 AAGATAAATAAGATGCAAGGAGG - Intronic
1005083054 6:21976604-21976626 AACAAATATCTAATGCATGCAGG + Intergenic
1006677579 6:35775579-35775601 AAAAAAAAGCAGAAGCAGGCAGG + Intergenic
1007101097 6:39247340-39247362 AAGAAATCTGAGCTGCATGCAGG - Intergenic
1009606504 6:65876194-65876216 AAGGAAAATCAGATCGATTCTGG - Intergenic
1010122473 6:72393426-72393448 ATCAAAAATCAGATTCTTGCCGG + Intronic
1010314547 6:74431601-74431623 AGGTGAAATCAGATGCATGTTGG - Intergenic
1010561907 6:77361364-77361386 AAGCAGAGTCTGATGCATGCAGG + Intergenic
1010978106 6:82339397-82339419 AAGAAACAAAAGATGCAGGCTGG - Intergenic
1011882976 6:92053968-92053990 AAGAAAAATAAGATTCAAGATGG - Intergenic
1012127374 6:95447784-95447806 AAGAAACATCAGAAGCAGTCGGG + Intergenic
1012236193 6:96819009-96819031 AGGAAACAACAGATGGATGCTGG + Intronic
1012503046 6:99911937-99911959 AAGATGAGTCAGATGCATTCTGG + Intergenic
1012585574 6:100918138-100918160 AGGAAAAAGGAGAGGCATGCAGG + Intergenic
1012622861 6:101368277-101368299 AAAAGAAGACAGATGCATGCAGG + Intergenic
1013356737 6:109351798-109351820 AAGAAAAATCAGATTGCTGGTGG - Intergenic
1014361511 6:120481840-120481862 AAGGAAAGTCACATGCAGGCAGG + Intergenic
1014517520 6:122398372-122398394 AAGCAAAATCAGATATATGGAGG - Intergenic
1015138891 6:129907677-129907699 ATGCCAAATCAGAAGCATGCAGG + Intergenic
1015366584 6:132402707-132402729 AATATAAATTAGATGCATGACGG - Intergenic
1015416648 6:132956731-132956753 AAGAAAATTGAGTTCCATGCAGG - Intergenic
1016055564 6:139574590-139574612 AAAAAAAAGCAGATGCTGGCGGG - Intergenic
1017513534 6:155135575-155135597 AAGAAAAATAATTTGCATACAGG - Intronic
1017762165 6:157577845-157577867 AAAAAATAACAGATGCAGGCTGG - Intronic
1018098072 6:160410311-160410333 AATAAAAATCAAATGCTGGCTGG - Intronic
1019145425 6:169972633-169972655 AAGAAAAGAAAGATGAATGCGGG + Intergenic
1019237922 6:170636551-170636573 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1019924262 7:4181910-4181932 AAGAAAAAAAAGATGCATAAAGG - Intronic
1021601058 7:22363895-22363917 AACAAAAAGCAGATCCTTGCAGG + Intergenic
1021726791 7:23554906-23554928 AAGAAAAATCTGTTTCAGGCAGG - Intergenic
1022019248 7:26382506-26382528 AACAAAAATTGGATGCAAGCTGG - Intergenic
1022138339 7:27470036-27470058 AAGAAAAATCAGATACTAGAAGG + Intergenic
1022560020 7:31338184-31338206 AAGACAAAGCAGATGCTTGTGGG - Exonic
1023343154 7:39243788-39243810 GAGACAAATCAGATGGATTCTGG - Intronic
1024895817 7:54260627-54260649 AAGAAAATTCAGCCTCATGCAGG + Intergenic
1026065015 7:67063435-67063457 AAGAAAAAGAAAATGCATACAGG + Intronic
1026200217 7:68207779-68207801 AAAAAAAAAAAAATGCATGCAGG + Intergenic
1026711852 7:72748433-72748455 AAGAAAAAGAAAATGCATACAGG - Intronic
1028152247 7:87387653-87387675 AAGAAAAATCATAAGGAGGCTGG + Intronic
1029660356 7:101956472-101956494 AAAAAAAATCAGATGGATTATGG + Intronic
1029992468 7:104974751-104974773 TAGAAAAATCAAATGTAGGCCGG + Intergenic
1030994980 7:116349264-116349286 AAGAAACATCACAACCATGCTGG - Intronic
1031052800 7:116961892-116961914 AAGAAATAGCTAATGCATGCAGG - Intronic
1031253979 7:119424157-119424179 AACAGAAATCAAATGCAAGCGGG + Intergenic
1032042588 7:128575667-128575689 AAAAAAAATCTCATGCATGAGGG - Intergenic
1032935894 7:136731174-136731196 AAGATAAATGAAATGAATGCTGG + Intergenic
1033427876 7:141261805-141261827 TAGATAAGACAGATGCATGCAGG - Intronic
1033874938 7:145804426-145804448 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033874981 7:145804734-145804756 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033991011 7:147287193-147287215 AAGAAACATCAGGTGCAAACAGG + Intronic
1035509848 8:170059-170081 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1037022932 8:13996305-13996327 AAGAAAAATAAAATGCATCTTGG + Intergenic
1037137001 8:15474574-15474596 AAGAAAAGCCACATGCATCCTGG + Intronic
1037344597 8:17885431-17885453 AAGAAAATTCAGATAAAAGCAGG + Intronic
1038309189 8:26432660-26432682 ATGGAAAAGCAGATCCATGCTGG + Intronic
1038647908 8:29376574-29376596 ATAAAAAATAAAATGCATGCTGG - Intergenic
1038907830 8:31927002-31927024 AAAAAAAATCAGAAAAATGCAGG - Intronic
1039039277 8:33392005-33392027 AACATAATTCAGATGAATGCAGG - Intronic
1039329529 8:36522002-36522024 GAGGAAAATCAGGTGGATGCAGG + Intergenic
1039499660 8:38006477-38006499 AAAAAAAATCAGATACACGTTGG + Intergenic
1043981613 8:86648103-86648125 AGGAGAGATCAGATGCATGGAGG - Intronic
1044113135 8:88301563-88301585 AAGAAAATACAGATATATGCAGG + Intronic
1044159362 8:88894072-88894094 AAGAAAAACCAGATGAGTGAGGG + Intergenic
1044320522 8:90795860-90795882 AAAAAAAATTTAATGCATGCTGG + Intronic
1044414583 8:91922126-91922148 AAAAAAAATCAGAAGCCTGTAGG + Intergenic
1045776625 8:105811000-105811022 ATGAAAAATCAGACGCAGGCTGG + Intergenic
1046026728 8:108733452-108733474 AATAAAAATCAGATGAGTGGTGG + Intronic
1046354126 8:113056669-113056691 AAACAAAATCAGATGCATTTTGG - Intronic
1046946667 8:119980431-119980453 AAGAAAAATGAAATGCACACAGG - Intronic
1046970709 8:120220263-120220285 AAAAAAAATCAATTGCATGTTGG - Intronic
1047257105 8:123222278-123222300 AAGAAAAATAAGATGCCTGCCGG - Intronic
1048194442 8:132320788-132320810 AAGAGAAAACAAATGAATGCTGG + Intronic
1048679297 8:136822059-136822081 AAAAAAAATCAGATGGTTGTAGG - Intergenic
1049696933 8:143988762-143988784 AAGAAAAATAAAATGCTTGCTGG - Intronic
1049930724 9:454083-454105 AAGAGAAATCAGTTTCAGGCTGG + Intronic
1050403548 9:5282661-5282683 GAGAAATATCTAATGCATGCAGG + Intergenic
1050574342 9:6977569-6977591 AAGTAAAATAAGATGGAGGCAGG - Intronic
1052356925 9:27514457-27514479 AACAAAAATGAAGTGCATGCTGG - Intronic
1052874083 9:33540016-33540038 GAGAAAATTCAGAAGCATGCAGG + Intronic
1053133019 9:35629171-35629193 AGTAAAAATGAGATGCCTGCCGG - Intronic
1053164884 9:35837296-35837318 GAGAAAAATAAGATGCATGTCGG + Intronic
1053321489 9:37102672-37102694 AAGAAAGACCAGATGCAAACTGG - Intergenic
1053501963 9:38604326-38604348 GAGAAAATTCAGAAGCATGCAGG - Intergenic
1054950704 9:70848295-70848317 AAGATAAATGAGATGCAGCCAGG + Intronic
1057133811 9:92672509-92672531 GATAAAAAGCAGATTCATGCTGG + Intergenic
1057154118 9:92825379-92825401 GAGAAAACTCAGAAGCATGCAGG + Intergenic
1057366868 9:94430818-94430840 ATGTAAAATCATATGAATGCTGG + Intronic
1057656468 9:96957247-96957269 ATGTAAAATCATATGAATGCTGG - Intronic
1058945350 9:109850529-109850551 AAGAGAAATCAGATGTCAGCTGG + Intronic
1059067365 9:111099570-111099592 AAGGAAAATCGGAAGCCTGCGGG - Intergenic
1059069996 9:111125357-111125379 AAAAAAAATCATTTGCAGGCTGG - Intergenic
1059844534 9:118259882-118259904 AAGAAATACCTAATGCATGCAGG - Intergenic
1059945667 9:119405987-119406009 AAGAGAAATCTGATGGATTCAGG + Intergenic
1059974763 9:119703764-119703786 CTGAAAAATCAGACTCATGCAGG - Intergenic
1060626431 9:125117010-125117032 AAGAAAAATCTGAGGCCTGCAGG + Intronic
1061372969 9:130208175-130208197 AAGAAAGATGGGATGGATGCAGG + Intronic
1062758128 9:138316847-138316869 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1203486326 Un_GL000224v1:58852-58874 AACAAAAATCACATTCAGGCCGG - Intergenic
1203382005 Un_KI270435v1:60552-60574 CATAAAAATCAGAAGCATTCTGG + Intergenic
1203498947 Un_KI270741v1:751-773 AACAAAAATCACATTCAGGCCGG - Intergenic
1186264541 X:7818420-7818442 ATGAAAATTCAAATGCCTGCAGG + Intergenic
1186939282 X:14487561-14487583 AAGAATAATCAGGCTCATGCTGG - Intergenic
1187033965 X:15518256-15518278 AAGAAAAAATGGGTGCATGCGGG + Intronic
1187414768 X:19083641-19083663 GGGAAAACTCAGATGCACGCTGG + Intronic
1187773095 X:22723939-22723961 AAAATAAATCAGATTCATACAGG + Intergenic
1187785138 X:22876234-22876256 AAGAATAATGAGATCCATGAGGG - Intergenic
1188681050 X:33005211-33005233 AAGAAACATCTGATGCATTCTGG - Intronic
1188712536 X:33418217-33418239 AACAAAAATCAAAGGCAAGCAGG + Intergenic
1189463078 X:41258256-41258278 AAGAAATATAAGAGGCATACGGG + Intergenic
1189993045 X:46612629-46612651 TAGAAAACTGAGATGCAGGCCGG + Intronic
1190647865 X:52539547-52539569 AAGCATCATCAGATGAATGCAGG + Intergenic
1190960994 X:55247428-55247450 AAAAAATACCTGATGCATGCTGG + Intronic
1192425302 X:71069642-71069664 AAGAAACAGCATATGCAGGCCGG + Intronic
1192831179 X:74752248-74752270 TATAAAAATCAGAGGCATACAGG - Intronic
1193776380 X:85647835-85647857 AAAAAAAAACAGATGCCAGCTGG + Intergenic
1194437012 X:93879185-93879207 AAGAAACAACAGATGCTGGCGGG + Intergenic
1194637278 X:96361360-96361382 GACAAATAGCAGATGCATGCAGG + Intergenic
1194709025 X:97211592-97211614 GAGAAAAATCAGTTGCAAGATGG - Intronic
1194953735 X:100155658-100155680 GAGAAATATCTAATGCATGCGGG - Intergenic
1195148350 X:102041223-102041245 AATAAATAGCAAATGCATGCAGG + Intergenic
1195201350 X:102553201-102553223 GAAAAATAGCAGATGCATGCTGG - Intergenic
1196369709 X:114963731-114963753 AAGAAAAATAAGATGCACATAGG + Intergenic
1196799382 X:119528987-119529009 AAAAAAAATCAGATTAAGGCCGG + Intergenic
1196962738 X:121021375-121021397 CAGAAAAATAAGATTCATGAAGG - Intergenic
1196991563 X:121334947-121334969 ATGAAAAAGCAGATTCAGGCCGG + Intergenic
1197067534 X:122251513-122251535 AGGAAAAATCAGATCCAAGAAGG + Intergenic
1197855012 X:130904982-130905004 AAGAAAAATCGGCTGGGTGCCGG + Intergenic
1198860865 X:141068811-141068833 AAGAAAAATCACATGCAAAAGGG - Intergenic
1198901827 X:141518572-141518594 AAGAAAAATCACATGCAAAAGGG + Intergenic
1199405641 X:147455726-147455748 GAGAAATATCTGATGCATGTGGG - Intergenic
1199411702 X:147531221-147531243 AAGAAAAATAAAATGCCTGAGGG + Intergenic
1199435152 X:147804672-147804694 AAGAAAAATGACAGGGATGCTGG + Intergenic
1199886921 X:152029455-152029477 AAGAAAACTCAGATTGGTGCAGG - Intergenic
1200588524 Y:5041055-5041077 AAAAAAAAAAAGATGCTTGCTGG - Intronic
1200856614 Y:7945582-7945604 AAGTAATATTATATGCATGCTGG + Intergenic
1201315196 Y:12638286-12638308 AAAAAATATCTAATGCATGCTGG - Intergenic